Description :
From Genome Similarity Track
Location :
Scaffold_179:68226- 70688
Transcript NameFunction/comments
Aphin_H310_13744cupin

Sequence
2462 bases(100 bases per row)
CGATCTCGGGCTTAACTTTACGAGTGGGCTGCTTGACGGCGGCATCGGCGGGGACATCGAGCTCTTTGCGGTCCAGTCCAAGCACCACACGCCGTGGCAT
TTTGACGCGCAGCACAACTTTACGGTTCTTTGAATGGTGTGTGCCGCCTACTGACGACGCCGTTCCAGGTCCAACTGGTCGGGACGAAAGAATGGTCGTA
TGCAAAAGGACCGCTGACCGACCCCATGTCGAACCTGCACTTGTCGTCATCCAACACGGCCTCCGTGGTCGGTAAGGGTTCCATGTGTCGTGCTCGAGAT
CCACCACATTTGCGACTACATAGACGACATGTTGGCGCATGCAATGTCCGGGGCGACGGATTTAAAGCCCCCTACGACCGAGATTGAAACAGTGACGCTT
CGGCCTGGGTCGGTGCTGTACTTGCCAGCGGGATACTGGCACTCGGTCACTTCGTTCGACGAAGGTACCGAGCCGACGACGCCAATGGAGGAATGGCAGA
TATGTTGTGTGTAGGCTCGTTATCGATGAATTTTTCGATTGACGGCGCACGGTGGATGGACGTTGCTTGGAATCGATTGATGCCGGCGCTTGCGGTGCAG
CCAGCATGGCGAGAACGCCCCAATTTTTGTCATGGGCCGGAAAATGCACGAGCGCAGTGGAAAGCGCGGTTGACTGCGTTGGCAAAGACCGTTCAAGCGA
TGGCGGATGCTGTGGACGTAGTCCTACCTGACGCGCTTTTCCACGAACCGGACGGAGAAAGTGGGGGCGACGAAGCGGCTCCCTTGACGTTGGACGCCTC
CGATGGCACTGAGGTGAGTACAACGAGTTCACGGAGCATGTAAAGACATGCCCACGTAGACGATCGCGCTTGAACCGTCGACTACTTTGACGCGGTCTCC
TGCCCACGTGTCTCAACTGGTGACCCGAACCCCCCTCGAGTACACAATCGCGATGGGAGGATTCCGAAGGTTTGCCGACGGGTGCAAAGCCGAGAGCCAA
AAGCTGGTCCAGATTCCTGAAGGCCTGCAAGACGTCGTCGAACACCTTCGCACGGAGCGTCCTGGTGCGTCATGGGATCTCGGGTCTCTCGAAGAGCGCG
TAACGGACGCATCCCTCCTTCCTCAGCTCCGCCGCTTCATCGACATCCTGCTCCAATGCGGGTATCTTCAAACGCTTCCAAAATATAGTGTAAATTGCTA
ATAGTGTGAGAGGTAAATGTGAATAAAAATTGGTGATTTTGCCTTTCAAGTAAACAAAATAAAATGCTGGATGGAATGCACCTGACACTATATTCCCGAC
ATGACACTATATACGAGATTTTCACGGTTGTGCGCCAGCTAAAGCCCATGTCGCTGTCGCAAGCGGACTTCAGACGGCTCTTGGAGACGCCCCGCGTCGC
GCCTCAAGGTGGAGGCGGCGGAACATTAAGCAAGGGTGCGATTCAAGCCAAGTTTGGGGGAAAAAGAGGATCGGAATCGTCGGGTAAGGGACCAAAGGAC
CGTGAGAAGTACAAAAAGTTCAAAAAGCCTGCTGCCGACGACGACAATCTGCAGAAGAAGCCTCGAGCAACGATGATTGATCCCACGTATCAGGGAAAGT
ACAGAGATCGTGCAGCTGAACGTCGGGCAGGTGTGAACCGAGACTACGAAGGTCCGCTATCCACATGGTTCACGTCAACATCGTCGGTAGTTTGACTTGT
GATGTCCTTATCTTCAGGGCTAGAAGACATCAACACTCAGGAAATGGATATTGAGACGACAAAGTTCTTGGGCGGTGACATGAAGCACACGCATTTGGTG
AAAGGTTTGGACTTGGCGCTCTTGGCGCAACTCAAGCGCGAAAAGGAGAAATTGCAGGAACAACATGCATCCCTTGTCCGGAGTGGGGCATTGCCATCCT
CGGCAACTCGGGACACTTCGTCGAGCTCCCAGGATACCTCTTCATCTCCAAATCCCCTCTCGGCGTTGGGTACGTAGCATCAACATGGATCGATAATTCA
TCGTGTGCACTAGGGTCATTCCTGATCAAATTCCTCCCAAAGTTGTCCGTCGACTACACCAGGGTCAAGCACGTGTCGGATTTGTTCCTTCCCGGTCGCC
TACACTACGAATTCAACGTGCACAGCCGAGACTTGGACAACTTGCCTCGATTCGTACAAGTCAGTCCAGATGATTGCCCTGGTGTGGATGCTGCCGGTGT
CCCTGGTTACATTTCTCGGGATTTGCTGGGCGACGTTCTGGACTGCTTTCAGCAACCCAAGCACGCCGCACAACGACGGGTGNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN