Description :
From Genome Similarity Track
Location :
contig_120:68215- 70247
Transcript NameFunction/comments
g13418.t1hypothetical protein

Sequence
2032 bases(100 bases per row)
ACGGAGGTGGATCTTTGTTCTCCCGTAGATGGAACAACCCGTGTACCGAATTGTGCTCGGTCCACATTGAGGGGGCCGGTGACTTTTCGAAGAACAGACT
CGAGGCCATGAAATACCTGTGGAACATGGCCAATACCTGTTCTCGTGGAATGCAATACTACTCGTGGCTCATGAGCGAGGTATACGTCCATTTCTCGGAT
GAAGGATCACAAACGGTCGCAACTGAGATCGCCAACGCCTGGACAGACGACAGAATCTCAGGATTTAGCTTCGACGTGCACTGGGCGCACATCTACTGCG
TGCGGCCCGGCGTATGGCTCAACGATATCATCATTCATGCTTTTCTGGAAACGCTTTCGCACAAGTACAAGAAAAACAAGACGATTTTCCTTCCACAGCT
GAGCAACCCGGCACCAGAGAAAGGTAAACGCATTCCCCAAGCCACGCTCAACGCGCTCGAGACGACCTCTGAAGACTTCGTCTTCATGTCGATCAATTTG
AACCGATGCCACTGGGCGTGCATCTTAGTAGACATGACGAAGGGAACACTCTTGTGCTACGACAGCGTGGACAGCCGTCCTCACCACAAGCTTCTGTCGG
AGTTGGCATCGGAGATGGTGGCAAGATCGCTGACCGGGTTCACGCACATCGCTGTGCACAACCCGTTGCAGAAGGATAGCAACAATTGCGGTCTCTTCGT
GTGCCTCTTTTTCTGGAAGCGACTGTGGAAAGAGGTAGGGAGTGACTACACAGAGGAAGGCCTTGCTCGCAGACGCTGGCAGATTCTGCATGCAGTTGTG
AACTTCGACAAGGAGAAGAAAGAAGATGCTAGCAAGTAGATCTAAGTCTAATCAATGAGCATTGCATTACGGAACATTTTCACTGTCAACTTCACTTTGC
GTTTATGTATTGACCAGGTTTTGGACATGTATCGTAGTGTAAATTGGCCATGTTCGCGGAACATGCATTGCCCAGGGTTTGAGTAAGTTTTGTGCATGCA
GATGTTTTGACAGGCCAAGCAATCAACGTTAGTGTACGTGTCATACTGTCCCTCTTTAATAGTTTAGCTGGCTTCTTCGACATTTAAAGCTGGACAGATC
GAATGGACAGGCTTGACCGACAACACCCACACACTCTCACTCTCCATTATTTTTTGGCGTTCCGCCAACATGTATCGTCCATGTTTTAGACATGGCCATG
AACAGGTTTCTTAACCAGAATTTATTTCCATATGCCTTCTGCTTCCGTCATTTAAAAGAAATCTTCCGCTTCATTTGAAAAACATGGACGTTACCTGACG
ATACCTGCCCAATACATGATAAAGTAGGCCTACCCCTTATAGAAAACATGGGCAGCATCAACAGCCATATTTGTTTCTACGTGGAGGAGCTGCAGGAGAC
GCTTCGACAGCGCTTTGGCCAAAATCTGTAGAGTTACATCGCTACAAGTATATTGCGGTTGTTTTGCTTTGAGCTAGGTTTGTCTAGGAAGATTATGGAC
CGGCGAGCCCGCGAGACAGTACCTATGGAGATCGAGTGCTTCATGAACAAGATGAAGATCTGGTATAGCTACCCAGAGCAGCTCGTTTTTATTGACGAGG
CGTCGAAGAACGGGTTGGATGCAACGCGACGCTACGCATGGTCACAGAGAGGAGAACGAGCAATCGTACGCACACATTTTGCGAGAGGTATTGTGCTTTC
TACTCAAAATTTCCATGCGCGATTGGTTGAATCAACCGCGCAGGCAATCGCGCAAGCCTGTCTAATTGCATTGTTCATGTGTTAAGAGAGATAATGTGTG
CACCACACGGTCAAATCTTTGCGCACTCTTCTCGAGCACACTCCAGATTGCACCCCACCAACAGCCAGCGGAAGGCAGCAACATGGTTGTTGACGATGAA
GAAACCGTCAGTGCTGTTGCAGCAGCCACCACCACCAGCCAAGGAGACGAAGCGACAAGTTCGCGCGAATTACCGCCAACAAGCCGACGTCGCAGTGCCA
TGCACTCGACGCCACGGTCAACTCCGTCCCGG