Description :
From Genome Similarity Track
Location :
Scaffold_878:6821- 8408
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_878-snap-gene-0.10Myosin

Sequence
1587 bases(100 bases per row)
TGGAAGTTGCGCTCACCCGGGATCTGCGCCACCACGCGGAACTTCTCCAGCAAGTACGTCTCGATGAACGCGCCGTACAGCGTGTTCGTCTCGGGCTTGA
ATTGGAGCTTCATGAACTTACCGAAACGCGACGAGTTGTGGTTGCGCAGCGTCTTGGCGTTACCGAACGCTTCCAGAATCGGGTTCGTGTCCCAGAGACG
CTTGTCGAGCTCGATCGCCAGCTGCTGCTGCTCGCCCGCGATGCCCTTGGTCTTGGTCGCTAGGTGCTCGCGCGACGTGAGGTAGCGCAGCACGATCTTC
GACGTCTCGGTCTTGCCTGCGCCGGACTCGCCGGAAATCACAATCGACTGGCAGTGCGCGGGCGTGCGCAGCGCCATCTGCTGGAACGCTACCTCGGCGA
TCGCGTACGGGTGTGGCGGGCGGTCTCCCATCTGGGTCTTGATGTAGTCCTGCACCTTTGGCTCGACGACGCGCACGAGCGGGTTCACCGCGATGAGCAC
GTTCGCCATGAGCGTGTACGGACGCAGGTTGTCCGGCTTCGAGCGCGCGTACAGGTTCTCCAAGATGCCGGCCTCGTGGATGTAGTAGAGCCCGGTCATG
TCGTCGACGACGCGCGGGTTGACCTTGTAGATGTCGCCAATGTCGCGCAGGTCGAGCGTTTCCTGCCCAAACTTGCCGTTAACCGTGAGCACCATGCTGC
CCTTGGTTTCGTCGTTCTCGAACTTGACGACCTCGACGATGCGCCAGACGCGCTCCGGGTCCGGGATCCAGATCTGGCCGCCGATCTCCACGGGCGCCTG
CGCGAGCGCCTTGACGACCTCCATCGTGCTGCGCCTGCGCAGCGAGTTGGCCGCGCGCTTTTTGTTCTCGAGCACGAGCCGCTGCGCGATGCTCAAATTC
GACGGGTCCACAGGCCCCGCGCGTTTGGGCGTGAAGCGGTCGTACGTCGGCAGCGCGCTCGACGGCGCGATGCCCACNNNNNNNNNNNNNNNNNNNNNNN
NNNCGGCTTGGACGACGCCATGCTTTGCTTAGTATGTTACGTTACGGAGAAGATCTTCCTTCACCTACAGACGGTGCTTGGAGGGCGCGACGGGATGTAG
AGTGAGGAAGGGGGGGGACTTGCGGGGCGGACGTCGTTTTCCCGAATGACCGACTCTCTCCTTCGTTCTCCTTTCTCTCTCGGGCGCTCGCTCGAGACCC
ACAGGCGTAAACAGACAGGAGCGCGTGTCGCTTTCCTGCCGCTTGCTCTATGACCGACGTACGACACAAGCCAGCTTCAAATTGGCGACCGCATACAAAA
TTCCAGTCACGTGTGGCATACAAACTCCCAGTCAAAACGCGCGGAGAGGGCGGAAGGTCCCCCCTCCCTCTTTCCTCTTTCCCCCCTCTTCGACCCGACG
ATTTGCCAAAACCGAATGTGTGTGCGTGTGAGTGAATGCGTTGGGATGAGATCCCAGTGTCTGGCTTGGGTAAAGTATGAATGATTTGGAATAGAGAAAA
AGACACAAACATGCGCTTCTGGAACATGGAACATACATTTTGGTTCGGGGTTTCTGTTTAGACACCACCGACCACACATGAGCGAGC