Description :
From Genome Similarity Track
Location :
scaffold_8:682063- 683596
Sequence
1533 bases(100 bases per row)
AGACGCGTGAATAGAGAGAGGAGATGCACCTCTTCTTGGGGGGCGAATCGTCTGCGATGCCGTTGGGCAAGAAGTACGTCATAGCCGGCTCATCGTCGCC
GTCCATTGTCTCCTGCGATCCTCTGCGTCTTGGATTGAAAAGTGTGGACTGGATGTCGGTAACCGCTCGTTGTTGCACGAATGTGTCGCGTGGTGTGGTG
TACATAATGTCGAAGTCATGTTGGACGTTGTTTCATGCTGTGCTATTTATTGTGATTTTGTTAGATGTGAGCCGGTGTCCTCCTCGCTTACAGCGTCCTG
CAGCCCACCAACGGCACGAAATGACAGGAGCCCAAGCAAAATTTGAGGCTGGGTTCTTTCTGGATGGCCTTAGTTCCTGAGTCGGTTTGTGTGTGAAAAG
TGTGACCGCTGGCAGGAAGCAGAGCGTGTGGGGGGTCAATTACAACACCATACAAATACCCCCGAGGAGAACAATGCGCTGAGGTGCAGTGCGTGCACCT
CTTGTTGTTTGTGCAGAAACCTCTCAACCAGGAGACTGGTCTCGCTGTGAAGGCTCTCATCAGTTGCCAGGGCAGTCGTCCTGCGCGTTCGTGGCGAGAT
GAGGAGTCGGGCTGCAACGAGGTGAATGTGAGCTCGGTGGATCGTGTCAGGTGGGCGCAAAATTCCCAGCAAACGTACCAAACAAGATAGCTCGGCTCTT
CTTCAACCTCTGAGTTTCCGCCGATGGCCATACGTGAAACTTGTAGCTCGAGCTGGTCGATTTCCACTACGGAGAAGAAAACATTGGCGATGCGATGAGC
ACAGTAACTCAGATGAACAGATTATCGATACGCGCTTCATACCTGGAACAACGGGCCGAAACCCTGCGTGCTGCGAGGAAGAGCGCATCTGGCGGCGAAT
TCGTTCCTGGTCGACAGGTGAGCATTCGGTAAAGTTGTGCTTCGTGCTGGGGACTTCTGTGTCCTGGTCTAAAATGACTTCGGTTCGGCACAATGGACAC
GACGTGTGGTTCCACAGCCACTTGTCTGCGCAACACGCGCTATGGAGATTGAAAGAGCGAGGTCATGTTAGCATTGGGCCAGCCTTGTGGTACGAGCGCT
CTAAAAGTATGACAACGGTCCAACACGTACTGGAAGAAGTGCTGGCATGGAAGCGTCACAATGTGATCGCCAATGCCATAGCGAAGCTGACAAATCGTGC
ATTCCTTGTTGGTTTCATTGGCCGTACCCAATGCCAGTGGGAGCTGGTACCGGACCTCGATCGGAAGTCCCCTTCAGAAGTAGACAAACACGGACAGGAA
ATTAGTCACCATTCCGCTGTAGTTTGCATCACTTCAAAAGCTACGCACTTTTCTTCAATCATCGGACTGAAGCACTGAAACTCGGGGCTGCTGCTGAGGT
CGTAGTCTCCAACCAAGATCTGTCGGTACATTTCTTCTTTTGCCAATTTGCTATCACAGCCACGCTCAGATTTGTCCGTGCTGTAAAAAGACAGAATGAT
ACACATCAGAAAGCGATCCATATATCCCAGGTA