Description :
From Genome Similarity Track
Location :
Scaffold_54:68205- 77157
Transcript NameFunction/comments
Phypa_INRA-310PPTG_15797hypothetical protein
Phypa_INRA-310PPTG_15798hypothetical protein
Phypa_INRA-310PPTG_15799hypothetical protein
Phypa_INRA-310PPTG_15800hypothetical protein

Sequence
8952 bases(100 bases per row)
AGGAAGCAGGTTCACCCTCTACCAACCAAAGCGAACATAGTCAAATGATGAAGGTGATGATCGAAACAAAACTAGAGACGACCATCGTAGCCAGAGCGTT
CTTTTTCGTACCAAGGAACAATAGCTCCCTCTACGAGAAGCGTGACACGATCGCAAACACGAGAGATCCATTACCTAGTCTTGAAGTTGAAGCTCGCCCT
TCTGCTTGGATCGCAGCAGTCAAAGGTACTAGTGACAAGCTAAAAATGTTTGATACTTAGCGAGTTTAATGACCTGCTTTAGCGTCAAAACGACGTCAAT
ACATTGAGAATACGCATGAACAACAGCGCTAGCCACTGGTTCACTGGTCAGCGTTTAGCTGGGCAATATTTGCAACTTCCGCCGTTACACTGGACTTGCG
TGAACGACTCGCGAAAGCGCCGTTAGAACGTTCCAGCCTGTAGACTAATGCGCCTTTTCGAGCAAGAACTACCAGAAGTCTGGATTGGTGTATCTGGGTG
GTACTTACAGCTTGTGAACTGGCGAAGCTTATCCACACAGTCAGGTTAGCTGACTGCTTAGTCGTTGAAAATCTCAATTGGAGCCGTCGAGCCGTTAACC
TGATTGTTGCTGGAAAAATGAGATAGCTTCTAGAGCTGTTTGTGCTTTACCTAGTTCCTTCTACCAACTGCGGTCCAGTCAACATCTGACCCGTGAGGTG
CTCACGTGAGCCCACCCGAATGGCGGACATTCAACTCGCAGTCACCATTTTCCATTCCTCCATCAAACGCAAAGCCGGTAGACAATCGTGCGCCAACAGC
ACGTCGGTTTAAAAATCTAGTAGCTGTCGAAAAGGCGATCAAGCCATCTCCAACGTAACCTCCTGTCAACGAAGTGCTACCAGTCGCCAGCTATCCGTCC
ACATTTTCCCTCTCGCCTTCACTCACACAGATCGCTATGAACACCGCAACACATTCATTATCAGCTTCCATTACGTCGGCGTTGGCGCTCAAGCCGTCCA
CCGTGTACATCTTGCGAGTTGAAAACACTAAAACCAGACAGAGTTGGCACATCCGTCGATGCTTTTCGGAGTTCTGCGAGTTGCGCGAGAAGCTCTTGTC
GTTAATCGACGATCAGATGGCTGCGTACCTCACCAGCTCAGACATGGACAGCTCCGAGCGCAGCTTCAACACCAGCAGCTCCACCATCAGCTCCAGCGCC
AGCACAGCCAGTATCAACTCTCTTCGTCTTTATTATTCGTCTCCACCTCCGTCCGATCGCTTTGCGTTTGTTTTCAAGCAGTTTCCGCCCCGTAAGCTGT
TCGGGTCAAGATCGAAACGTGTGATTGAAGCGCGATCTATGGCACTGAATCGCTTCTTACAACAGGCACTGGAAGTTGTGGAGGTGGTTCGACAGCGTCA
ATTGATCGCTATTTGCTTCAGTATGATGACTCATATTGAGACTTTTCTAGACTGTGGAGCTCATCGACAGGTCACGCGTGTGGGTCCATCCTGTAGTCTT
GACAGAAGCGAGAGATTCGTAGCTGAGTCTCCCAGTGCAGCTAGAAGAACATCAGCGGCAGTGTCACTTACTCCAGGTTTCCACCACTACCCACTGGTGC
CTAGTCCGGCGTTCACTATGACCCAGACAGACGACAGATACCAGTCCTGTACTAGCAGGTACGACCTCAGTGACGAAGAAGATAGTGACGACGCTCAGCG
CTTCAACAACTTCGACTTTACACGGCGATTCTACTGCGAGTTTGGTCGTCAAGAAGAGCGTGCCGAGATTTATGATGAAGACTCGGATGACGAGGAGATG
CAGATGCTCAAGAAGACGTGGAGTGCCATGCTGGAGAGCGAAACCCACGAGAAGAAACTGTACCATACCGGTAGTCATATCTCGATGTTGGAGAGTGGGC
ACACATCGGAGACGTGGGCGAGACGCATTGAAATCGCCGGCATTCACAATGCCTCAAAAAGTGAAGAGCTAAGCGCTACCTGTCTGGTTGGGAAGACACC
CGAGCTCCAAAGAACAGAGCAGCGTCTGGACCGCCACCGATCAAAGTATCCCGTTCCGGTCCAACACAAATCCACGTAAGAGGGATAGATATTCTGTGAT
CTATGAGTAAATACGCGGCGTGAGTATAAGCTAGCAACTTGCCCATCACAAGGTCATGACCACAGTTTTCTGTGGAAAACTACTTGTAGGATAGCACTTC
GAAGCAGTAAGTAATTTATCATAGCATGATCTCTCCTTTTTTTAAAGAGTTACTACAGCCCTTGCGATAAATAGATTTTCGCGTTTGCTGTACTCGTGTC
TCTGGATGGATCCGCCCAGTAGGGCTGCAGTCAGCAATACAAGCATTTTTTGCAATTGCTGGTGTAAGCCATTCGGCGTATTTAGTCAAAGTAAAGACTT
CAATTGCAATTTAGTGGTTAGAGATAATGAGTGCTCACTTTTAGGCGGTATTTGGGACATATATGAGACAGCGTCAAACAAAAAAATACTAACGAACCTA
AGTACGAATCGCGATTTTAAGCACACAGTTGTAAAGATGAGCGTCTCCCTCTTTCTTTAGAGCCCCCGTACGCCTTCCAGAACCGACAACCGACCAAGTT
ATAGCTTCACCAAAAAATTATCTCCAGCTCCAAAGGGAAAATGTAAAAAAAAATATTGGTTACTTAGATGTAAAATTTCACTGCGGAACCGATGGCGTTG
TCCGTTTTGTCTAATTCGACACAGAACCACTTCAAAATTTATGTTTCTTGCACAAATTCACTATAGTGACTATTGGCCCATTAGTATCAATATGTATCCT
ATGGAGATAAGTATCATCATAGGTCTGACAGCTTTCTGTTTCACTTGCGAGACTTTTTCGGCACTGGATGGCCTTCATCTTCGCCATCTCTTCCACATCG
GACTTGGTTGGCTTTTGCCGCGACGGCCATGGCTGCTCGGTGCTCTCGTCGAGCCTGTTGTGCTGCTTTAGCATCTTCACCTTGTTCTTTGCTAGGGGCG
GCGTATATCGAATTCGCTTGGAACTCATCCGGAACGTATGGCCGGATATTTTTATGCAGTTCTGCTATTTTTTCGGCCTTTTCAGCTAGAGGTGGCAGGT
CGTCAAGGAAATGGTCGAGCATACGGATGGCCTTGACCACATCCGTGAGGACGCCATCCACTTTGCGGCGAAGGTCCTTATCGATGGACTCATCATCAGG
CCCCTTCTTGCACTGCACGACACCCGGTTTCTCTTGTGTCATGGTGAACACCTGGTACTGTTGTACACCCACCAGCTTCTTGTAGAGTTCTTCGACTACA
GGCTTGTAGCTCTTAAAAATTCGCTCCCACGAGAGATATGAACGGTCCTGTTAGATGCGGCTGCGTCGTTGACTGCGCTGATAATGTGGTCCATGGTCCA
GCAGTCTGCGCGGCTTATGTGCTTGCGAATATGCCCGAAACCTCGGTCGCACGAGTTTTTTTGTGTGGCCCTTCACAAAAAACTTATAGTCGACTCTCTC
AAACGCCCCATATTGGACCTGGGCCAGAAAGAACCGGATGACGTGGTTGTTTTTGTTCTGTCCAGAACAATTGTCGGCGTAAACCACAAGATGCTTCTTG
CCTGCAGGGATCAAGACAGTGCGGATAAAGTGCTGAAGCATAGAGTTTATCTGGTCGCTTCCTTTACCACTCGCGAACTCATCATACACGTAGTTTGTCT
GGGTTCCGTCGTTCTCGTAGAAAATACCAAAGAGGTTCACTGCTAGCAGAGAGCAGAAATACCACTGCGAGGGCGTTGTCGTGACCGAGGGAATTGTGAG
GTTCTGTGAAAAGTCAGTGACTATCACCGCCAGATCAGAGTTGGGTTCCTGCGAGGCTGCTTTATCTTTCTTGTATTCACGTCTGCAAATTAAAATGATA
CCAATGTCCTGGTTAGGTATACCCAACAAATTAAAATGATACTTCTCTCCACGAACCACATTCGACGTGGTGACTGCGTGTGTTGATCAAGCTCTTCCGT
TTTGTCAGCGGTAGCCCCCTGACGCATGCGGGTCTGGTAAATTGTGCACATATCGCACACATTGGACTGGGAGGAACGGATCCGGATGGTCGGACAGTGG
ATCGAGAGTAACTTGCGAGACGTCGAGCGTGCTGGTTCATACACCCGAAGACCTAGCTCCACAAACTTGTGCATCTCTTCGTAAAGAGCATCCCAGGTAA
AAGTAGCAGGCAAGAGCGTGTAGTCTTCGCGACTGTAGTACTTCTTTACCATTCAATCTTGCGTCTTCTGCATTCGCACTCTAACTTGCACCACTTCACC
CACCTCTGCGGCAAGAGCTTTGAACCACTTGACCAGCCACACTAAGTTCACCTTTAAAGCGTTTTTGTTTGCCTTATTGCCATGCGCAGCTGCAGCGATG
AATCCATCGCGAACACGCCGCTTGTATCGCTGCACGGTGAGGGGCTGCACCCCCAGGCACCTTGCAAATGAAGGGCGACAGACATGGTCAACAAATGGTA
GGTAGTAGTGAAACTTTTCTCGTTCGCCGGTACCGCGACGCCTCCCCGCCGTATCTGTCTGCATCAGCACGCCAATCAGTGTCAGAATACAAGTCGTCTT
CTCCGTCCTCGACATTTGCTCCAGCGGGCGCACTAGATGCTCCAGTTCACCAGCCTTGCCTTCGAGACAGTGCCGCTCACACGCATCGTCGCGTATGAGA
TCCGTCACGTGTTGACGGACGTCATCGTCGATCAAATTGATACTAATGTCCTCGGGTTTGTCCGTTTCTTCTTCACTCTCTCCTGTCAGCACTTCATCTT
CAACGGAAGCATCATCCGCGTCGCTCCAATCTTCGTCGTTGCTGTCGTCGGGTTCCTCGCTTCCTTCCTCTTAACTTACATCGTTCGTTGCGTTGACTTG
GGTGGGAGCTTCATCAACTGGATAGGTGGTATCTTGCGCCAGCAAAAGAATTGCTTCCTGCAAAGCACCGGAAGCCTGAGACACAGGCACAACACCAGAC
AATTCTGCGCTGGATGGAGGTGCACTAGCAGATGGTAGGTCAGGAGTGGGCGACTGTAACGGGAGCGACGGCGGAGGCGAAAGTTGATGAATCATCGTTG
GCTGGACACAAGTATCTTCAAGACGGTGTAGTTGGTGAGTGAGCTCGCTTTGGTGACCATTCGGGTTTTCAAATTACAAATCGGCCGTTTGCTCAAAACT
TCATATAAGTACGAAAATCGATGGCCCAACTTTGAACGCGATTATCTCGATAACTCTAAATGGCGCATTAGTATCAATTGGTTCTGGGTTGTCTCATATA
TATATACAAAAGCAGGACGTTATCGTTGAAACTGGTATGGCATCTCGAGTTGGCTCTCGTCTGTGGACCTAGCGACAGAGCTACGGGAAACCCTCTCCCT
CTCTCACCTCGATCTACTTTGGCTCCTTACGCCAAGTTCTAGGAGAAGATCGCTTTGTAGTTCCCGCAGCGCAGCTGCAGCGTAGTTGCCTCCAGGATAC
CAGAGAATGCAAGTAACAGCAAAGGCAGTAGATTTTAATACTGAGCAAATACTAGAATCGAATTATTTCCCTTTTCTTGCGTATTCATTGTACTGTACGT
GTCATAGACGAGGAGGAAAGACCGTTGGACATGCAGAGCACCTTCAACAACAAAACCCCTTTGAGCGAGCGCATCCCGACGCACGGCACGTAGATCGTCT
TGTCTCTCATGTCTCCAGGCTCCAACTGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNCGACTATGTGCGAGGCCTTGAACTACCACGAACCTCGTATGAGGTACGAGTTCTTCCTGGATGGCCTACGTAACAAGCAAATGAAGACGGTATTG
AACGCGAGTATGGTCACGTCGATTCCTGAAGCGTGTGCGCTACTGCTGTACAAGAACCTGCATCTCCCTGTCGAGGAAGAAGACGAGTTCGCGGGCGAAG
TCACGGGTCAACCAAGGGCGAATGGAGCGGCTTCGACTGAGTCCCAAGTGCTCCAGGAGCTACGTCAGATGAATCAGCTGATGAGGACGCAACAGCTAGG
GCCAGGAACGCCGAGAGGGCTAGTAAGCGCTGTGGCTCCTCCGACTTCTCCGCGCGACGGCGTTCCAGTGGTGAGTAGGAACGCCACAGGTTCGGCGCTC
GGGCCTCTACGCATTCGTCTTGGACCGGACACGCGCACTACCGAGGGTGAGGTGGTCTGCGGTCGCTGCGGTCGGATCAGATGCAGCCGCGAGACCTGCC
CAAGAGGACAAGGCCGTTGTAACAGGTGCAACGAACTGGGTCATTACTCTAT