Description :
From Genome Similarity Track
Location :
Scaffold_996:682- 4188
Sequence
3506 bases(100 bases per row)
GAGCTACTCCGACTCGGCTGTAGACTCGGAAGACGATTACATCGACACCGGGTTCACCAGCGACCGCGACCGTAGATCGGGGGACCGAGGGAACTCAGCT
GGGACACCACGGAGTGATCACCGAAGGGGTCAGCCGAGCTCGGCTGACCGCGCCAGTCGAGGATACGATCGGCGTGACCAGACTGGGCGGCGCAGTGACT
CCCGTGAACGCCCTTCGTATGGACCTTGTGCTGCCTGCGGTGGTGCAAACCACTCCGTTCACTACTGCCGCCGTCGCTGCAAGTTCTGCAAGTAATTGCA
CGATGTCGGTCAATGCGAGCTGTTCCAGCGCTATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNGCTACCGCTACCCTAGCGCCTGAGGAATTAGCATTGAGCGCGGAGCCTACTGCTGACTTGGTCAATGGCCCGCCTAGTCGAGCAGAGATCACAG
TGACGGCTGGTCAAGAAGCGCCCAGCCAAAACGCCTGTGCAGCAGATGAGTGTGAAAGTGAGCAATCCAGCGATTTGTCTGACTGGACGATCATCAACGA
CCCCGGGCCCAAGCCGCCGAGTCCAAGGCTCGAAGATGAGGTCGATGTGAGCGACGAGCCCATGTCGTCAGACCCGGAGGAAGACCTGCGCTTACGTTAC
CTTCTGGCAGCCAAGTACGAGGACGAGACAGATGGTCGAGGCGACTCGGCGGGAGACTCAGCCGAGTTCGAGCACCAAGCAACGAACTTGGAGCTCGAAG
GCTATGCTCGCGAGTTGGCGTTCCTGCCCGATCTGACTGAAGCGGTGTCGACGCCACTCGACTATGAAGCGCCAAACGTTCGGAGCTCGGCGCACACTCG
GCCACAGTCTACTCGGCTGGTGGAAGTATTGAAGAACCATGAAAAGATCATGATCTCCAGTCGTAATGCCCTACCTCCACCAGCATACGGCGTAGTGTGT
GGCATCGACGTACAGGGGCATCCGGCAATCCGCCAACGAGCCCGCCGAGTTCCGCTGAAGCATCTCGGCAAGTTGTACGAGCTGCTCAAGGCGCTGTTAC
GGGCTCGGCTAATTGCCTTCTCGAACAGCCTATGGGCATCACCCATCGTGATTGTCCTAAAGAAGAATGGGGTCGACATTCAGTTGTGTATCGACTACAA
GCTGGTAAACGCGCTTACGTTGCTCATGGAGTATGCCATGCCGCTAGTGGACGATCTCCTCACGGAGCTGGAAGCGTACCTATGGTTCTGCTCTTTGGAT
GCTGCTAGCGGTTTCTGGGCGGTCATGATGACTCGACGGGCGCGTTGGATCTCGGCTTTTGTTTGCGTGATAGGCCACTTCGAGTGGCTGCGGATGCCCT
TCGGATAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNN