Description :
From Genome Similarity Track
Location :
Scaffold_379:682- 3763
Transcript NameFunction/comments
Phymu_g9276hypothetical protein PHYSODRAFT_521725

Sequence
3081 bases(100 bases per row)
CTTCTCTCACTCGTCCCTTCGTCACGACCGCATGTCCCccttctctttcttggaCAGGTCGCTGCCGTGTGAGCCATCCAATAGACCAGAGGAAGGAGTG
GCACTCTCCTCCCTTTCCTCCCGCCCCCTTCAGTTACGAGGAGCGGCCGGAGCGGTTGTTGTCGCCGCCAGCCCCCTCAAAGCCTCTATGGTCGGACACC
GAGTAACGGTGTGTCCCATTTCCCCGCAGAAGTAACACGTGTAGGGTTGATTGCCGCCGCCCTGAACACTTCTGCCACCGTTCTGGGCTTCGCATTCGGC
TATTTATATGGCCGTATTCACGCAACGTCGACAGGACATGGCACGACGCATACCCGTCACGCGCGTGTGTCTCTTGTAGTCACATCTTCCGCATACAGAC
TCACCGTCCTGGGTCCTGCTGTCTTCAGCCATCTTGATGTCACGACGAGCACCATCGTTACCATTCCCACCGTTCCCTGGCGTATCCACAACAGCTGACA
CGTTCGGCAGCCGACTCTGTGGATCCACGGGTTGCTCCCAAGGGCCTCCATCATTTGCTGTAGCCAttggtgatgctgctgcatgaaaGATTGCAGTTGC
TGAGTCAAAGCGCCCACTGAAGCCGTCGTCGATGCTTTAGCGTTCCGTCTTCGCTCAGCGCCTCCGtccgagaactcgtcgtctgcttccACGGGGCGAT
GCATATCCTTGACCATTAGCCATTTGCAGGCTTCCGGGATATCTCGGGCCGGACTCGAGTCGAGCACCGCGAGCATACACTTGTTCCGTAGCCCCCGACG
GAACAGTTGGTAGCGCATCTGTGGGTTGGGGTAGTTTAGCGAGTCGCACAGGTCCGTAACGCGACCACCCCATTCCTCCACAGATTCTCCGCGTTGACGC
TTCGTTGTGTGAAGCCGTTCCCACAGTTCGTCCGCCGTGCGGCTCAAGAACTGATTGTGGAACCTCACCTTCAGCGTAGCAAACGGCTTGATCCTTGAGT
TTCCCCACCATCGCTCAACCTCTCTTCCTTTTAGCTTCTGACGGAACACTAACAACCGTTCTCTGTCAGGAAGCTGGCGAGTGTGTACTTCGAACAACTC
CCAGAAATCGCGGGCCTTCTCAACCGTAGCCATATCAGAACAAAACATGGGTAGTACCTTGATCACGTTAGACATTAGCGACGTGAGATCCACCGTTCTT
GGGGGCGGTCCTCTAGGCGTTCGACTGCCTCCATAGGTAACATTAGCTCGTTGCATGGGAACGGTCTGGCGCGACGGTCCCTGTGAAGCACCAtgcgtcg
tcctcgtagtAATCGTTGCCGGGTTGACCATACAGGTCGGAACCATCGGAGCAGTAGGTTGACGTCCTTGAGGTGGGCCATACGGGGTTGGACCCGGGGC
TCACATCGGTACCGGTTGTCGTCCAGGAGGCGGTACGGTCGTAGATAACGAAGCCGTTGCAGGGGCCGGGCTAGCTACTACCGCAGGGTTCGGACCAGGG
GGGGGTTAAATCCCTTCTGTTTCTGACTCAGGGCGTGCAAAGCCGCCTCCGACGGTGACAGTAGAGCGGCAGTATAAGCGCATACGTCGCTCCCGAAGAA
ATCAGTGTCAGCGTTCCGTCCCCAACCGACAGCACTATCCATCCTACGATTCTCCGTACCGGTATACATGGATATAAACCCAGTAGGAGTCGGCGCGGGT
TCCTTAGACAACTCCTCCTCGTACATGGGCACGGACACCTCTTGCTCATACATGGGTTCCTCGTACGAAGGGTAGAACATCCGGTCATAGGTCGCTTGTT
CAGCCACCGAGACGTCCCAGGGGTCCCCATATATAGCCCAGAACTTCTTGTACGCCTCAGCCTTCCCAGCGTTACTAAAGAATGGCGACCGTTCCGTCTT
CACTTCTGGTTCATcggcttctccttcatcatTAGGCTACGGAACCTCCTCCTGGGTCTCCGCGTCGGGGCCTTCATCATCTCCTTCCTCCTTATTTTCC
TCATCGTCACCGCCTCCCGCAGCCAAGAGATCTTTCAGCTCCTGTCGGAGCGAGTCTCGTCCAGCGGCAGTAGTCACACCGGCCGGTGACTCCGTCTCCT
CTTCTActtctccctcttcttcctcagcgTCCAGACCTTCAACCCGGACCTCAGCAGCTACTTCACCAAAACCgcgttgagcttcagcagcgcgctTCTG
TTCTTCTCCCTCCAGTCGCCCCACTTCCGATTGGACGAGGGCAGCCTTTTGTTCCTCAGACCGTCCCTTCCTAACTTGAcctttctcttcttctttcgaA
ACATTGTTCTGCCACCTTCACAAGAATATTCACTTCCTTACTAGGATCACCTCAATTATTCCGCGCTACCTGCGCCTCCGAGACTCCACTTCACGAAGAT
GACCACCTGGGCTCTATACCAGACCACGGCACTACCGATTCTTGATCTTCAAACTTCCCCCAGTTCTCTCTGGACGTGAAAACCGTAccctgcttctcca
ccaggtGTCGCGAGCGTGCTCTTGGACGAGACGGTAAACAGTCGGTTTGTAGAGGAACGATACGGAGGGGTTCTGTGTAGAACAGTTTGATACCAAAAAC
AAGTCAAAAATGCAAAACGAGCTCTTTTCAACTTGCTGTGTCCAAGGTTAATTCACGACTGACCTGCTACTGACCTCGCCGCACCTTTGCTCCCGCGGTC
CTTCATCGTCGCCCGTCCTCCTTTGTCCAAGCTGTTCTTTCCCGGTACCTCCTCGCGGTACCTCACGCCCCTCCTTCTTGTATACTCAGCAAGCCGTCCT
TCCGAGCGAGACGCTCCGTGTCTTCCATCCTCGGCATCAGCAGTTACGCAACGCGGCGGGCTTTGCAGCGGGACCACGTGCGCCCAGAGAACTTCCCCGT
GAGAGCGCCTGTTCATCCTTCTTCGCGAACCGAGGCTCTTGTCGCATACTCCAACTCTTCATCCAGTATCGGATCCTCTCCAAGTCGATCCTCCCAAAAT
AGATCTTGATCAGTATGGTTACGAGAGGAGGGACGGTACGGAGCGCGACCCAGATGGTGTCCACCGTTCTCACTCGTGACA