Description :
From Genome Similarity Track
Location :
Scaffold_257:6817- 7821
Transcript NameFunction/comments
g16181.t1hypothetical protein

Sequence
1004 bases(100 bases per row)
TACGGCTTCAGTCGCCCAACGTAAAACATTGGGTGCAAGCGCATGCTGGACGGTATGTCCAGTGTGTACGCGTTGCCATGCTTCGCCAACACGGTGAATG
GCCCAATGAAGCACGGAGAAAGCTTGCTTGCTCCGAAATCGGAAACTGCATGTTTAGCTAGGTTCTGCGTAGCTAACAGAACTAATGAACCAACTTTGAA
TTCATTTGTGTTTTCTCTGCCGGTGTTATCGGCATTCAGTTTCTGTCGATCGACAGAAGCTGCTATCGCGTCCTGGACAAACCGAATTACGGCTTGTCGA
CGCTGGACAAAGTCCATTGCATCCGAGCTGAACCCCTGGTTCAGTTCGTGCTCCTTGTTCGCAGCAGGCCCGGCCTGCGCGTGATGTTTGTTGTCGTTTA
AAGTGTCTACGCCCGTCGTAGACACTGTCTTGTCGTCGCCATGACTGCGCGCAGTACGTGCGCGAGTCGTCACAGCTGATGCATTGCTTGTATCAGCGTG
CTTATCCGGTTGTTTTGAATTAACCGGATACCCTCCCCCACTTAAGGAAGGAGCTACCGCACCGAGTACGCTCGGTACGCGTGGGTGCCTCATGACATTC
ACATAGAACGGTGTGTGTCCTGTCGAGACATGCACCAAGTTGTTGATGGCGAACTCCGCCATCGGCAAGCAGTCGCTGCATTGATGGAACGAGTGCGCGT
AGCTCATCATGGTGTCAACCAACACGCGGTTGACACGCTCGCTTTGTCCGTCGGACTGCGGGTGATCCGCAGTCGACATGGACAACTGCGTCCCAAGAAG
TGTAAACACTTCTTGCCAGAATCGCGCTGTAAAGCGCGGATCCCGATCCGACACGATGTCGAGTGGCATACCATGGTGTCTAAACACCATGTCGACAAAC
AGACATGCCGTCTGTTTGGCTGTCACCTCGGCTGGTACTGCAGCAAGATGCACCATCTTGCTGAAGCGGTCAACAAAGACCACCATACCAGTCCTCCTCT
TGTC