Description :
From Genome Similarity Track
Location :
Scaffold_720:6814- 11565
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_720-fgenesh-gene-0.1Conserved gene of unknown function
Pytiw_DAOMBR242034maker-piw_contig_720-snap-gene-0.10Cullin-associated NEDD8-dissociated protein

Sequence
4751 bases(100 bases per row)
GATCGACTACGACGCACTGGAGCGAGCGTGGGAGGCAGGCGACGCCCGCGAGGAGCTGCGATCGCATGGCAACGAGCAGTTTGAGGCGCTTTCAGACAAG
TTAGCGCTCGTGTTCCTGTGTGAGCAAGGATAGGCATCGACCTTGCTTTGGAATTGACGTGTACGCTTGCTATGCTGCGTACCTCAGAAGTGAACAGGAA
GCCAAGAAGCTGGGTGCGCAGATGGTCTTCGTCACTCTTCGAAAAGATCGCGCCAGTCCACAGGAGCCGCTCGCCGAAGTAGCATCACGCTGGAAAGAGG
TAAATGGTAAGTCAGTTCAGATGCTGTGGACATGACTCACCTTTCTAATCTTTGCGGTGGTTGGTTGTCTTGCGCAGGCGCTCTGGAATGGCGGACTGGA
GGTGACCGTCTACGAGATCGAGGAGGGCAAGAAGCTACTTGTGGGGCTTCAGCAAGGCATCCAAATCGCGGATCTCCGTAGGTTCTTGAGCGAGCAGCCG
GACGTCCTCGAGTTCGAGTGGAACAGCAACACGTACGCGAATGCCAGCAAGCAGCAACAGCACAAGAGAAGCCGCAAAGCCCAAAAGAAAGAGAAGCGGG
CTGCTACCAAGAGCTCAAAGAATAAATCCAAACAAGCCACGCAGATAAGCAGTAAGCAAGAGCCCAAGAGCGAGCTCTAAATGCAGAAAATGTTCAAACC
TTAACACGCACAACACCACCTTCTCCTGCAGTACCTTCACAAGTTTTTTTTCTGTTTCTTGGTCTCCATCAGCACAACTCTCTTCACTGCATAGTCAGTC
AGTCACTCACTCATTCAGCACCTTGTTCTCGTCAATGGCAACTTCAGCCGCTGATGCGCTCGTTCTTGATGGCCTCAAGCTGCGGCGCCAGCGATTTGTT
CTTCTTGACGTTTTCAAAGAAGAGGCTGAACTTTGGGTGCGAGTCCGTGTCGCGCACGCTGTTGATCGCGTCGACAGCGCGCAAGGCGCTGCGGATGAGA
TCCTTCGCGCGCTCCACCTCCGTGCCGACTTGGTCCTCCTTCACTTTCTTGTTCGCAGTCTTTTCAAGCGGCTCGACAAGCAGGTCCAGCGCACCGACGA
CCGAGCCAGGCTGCACGTGACAGATCTTGACCAAAATCTGGTGGGAAAGCATTTGGATGTCGTCTTGGTCGCGAAGTCCCTGCTGCAAGTGCGGGAAGAG
CGACGCAATGTCGAGCTGCTGCGGCAGCGTCTCGATCAGGGTGTCAATACACGAGTATGCCGCCTTGCGAATCGGAAGACCGTCGTCCACCTTGTGCTTG
AATGGGCCGAGGTCGACCGTGCGCTCGAGCTTGATCTCCGTCGCGGCGAGAAGAGCAGGGAAGATTGGGTCTCGCACATACGGGATCCAGAAATGCCCGT
GATGGTGGGCGCCAGTGTTGAGCGCCAGAAGCGCAGCACGACGCACATTCAGATCTTCATCTTGAAGCGCATTCAAGAATGGTGCGATGTGTGAGAACAG
CTTCTCAACAGCAGCTGGGTTTGCCGATGCCGTGAGCGCATACTTGAGGCTCGTAACACCAGTCCAGCGAGAGCCCACAGAAGTAGATCCGCAAAGCTCA
GTGATCACAGGGATAAGCTGGTCGCCGTTCGTAATGGTCAGCTTGCCGAGGCACTCAGCCACCATGTTTCGCACTCCTTCTTCCTCGCGCTCGCTCATTT
TCTTCAGCACTGGAAGTACACGGGCGACGTAGACAGTAAATCCGTGCTGTGGGCTCGCAGCGTGGTCAGAGATGACTTCACGCAGCGAGCTCAGCAAGAG
GTACGAGTTGACTCCTTGCTCGATCTTGTGCATGATCGTCTCGAGGTACTCCTCCGTGTTGCCCACGCAGATACTGCCAAGCGCATAAGCTGCGGCCGCC
TTCACCTCTTCTCCATTCGCAGAGAAATTTTGCAGAATAGTCTCCTTGACATCCGCGTACCCCTTCAAGTTGATCTGGCGACCGAACTCTCCAAGACTGT
AGAGCGCGACGACCTTGTTCTTCTCGTCTGCGCTGCTGATATCTCCAACAAACTTGGAGAACGCGGACTGGCGGTTCGCCTCCGACGTCACGACGCAGGT
GGCAGCAACGCAGCGCGCGAGGTTCAAAACCGAGTGCTTGGAGAGATCCGATGGAGAGTCCATGAACGCGGTAAACAAATCCGTGAAGCTGCTTCCAGGC
AAGTTGAGCTCCGTGAGCTGAGCGAAGAATCCCTTCAGCGCCTCCAAAGTCGGACCTTGAAGCATGGAGCTGCGGCAGAGCGAGATCGCGTTCACAAGCG
CCTTCTGCAGCAAAGCGTCCGTCGACGCAATCGTTGGCGATATGCGAAGAGTGTTCGAGATCAAGACGATACCAGTGCGGCAGAGTTGAAGATCGCTGTC
AACCACGAGGTACGAGGCTTCCGAAACCACGTCGCAGAGAAGCTCCTGTTTGATCTGGGCCCCCTTGTGAAGCACCAAGTTGTTCAGCGCATCCAGCGCC
GCCTGTTTCAAGGTTCGCGACTGCTGACGAAGGAGCTGGGAGAGCGCGACGATGCATTCCGACAGAATCGAAGACATGTCGATGTTCAGCTTGGAGCGCG
CGATCACAGCAATCGCTTTCATGCTCTGCACACGAGTGATCTCGTTGTTGAGACGTTCCATAAGCAACGGGAACACTTCGTCGATTCGAGAGCTCAGTTC
ATCACCTAAACATCAGACACATCATGTGAGCACTCATATTCTCTGGTCAATGAAATAGGTACACGAAAGTCCAGGCACGTACCGAGTTCCGCAACGATTT
GTCCGATGCTGCTAATCGCAGACTCCTTGATTTCTTGGTCGATATCGTGGGCCTTCAAGCTCGGGAGGACGGCTTCGAACACCGCCACGGCGTGGCTCTT
GGCAGCAGCATCGTTGATCTCCGAAATCACACGCACCAGCGACTCAATCAAACCCAGCGCTTTCGCCACAGTCTTGTACCAATCACCCTTGGCGCAGTGG
ACTGCAGCGCGGACAATTGCACCGATGTGTGCACGGAAAGGTTCGGCCGGGTGGGTGTCGATGAGCAGTCGGAGGAACACGAGCGCATCTAGCTTCAAGT
CGGAGTGCTTGTCTTCAGCCGCGCGAATGATGTTTGGCAACAACACGTTGATGTAGTCTCCAAGCTGACCGCGTTCCACTGTCGCCAGCTCGCTCAGTAC
CGCAATCACAGCGCAGCGCGGCGAGACAGACGCTTTCGGTCCAAACTGCTTGTTCGCAGAAAGGACGATCATTTTGAGACGCGCGCGAACCTGCTCGAGG
CACTTATTCGACGGGTGTGCAGAGCCAGCATTCGGAAGAGATCGACGAGTTGCACGAAGCAGTTCTGTAAAGACAGAGAACACGTCGATGCGGACGTTCT
CCTCACGCTCCTTGAAGCGCGAGATGATTTGCTGGCTGTAGTTCTCATACAGGTGCTCCAGCAGCTCTGGACGGGACGAAATGATCGCCGTGAGCACGCG
AAGCCCTGCACGACGAACCTTCCAGCTGGTGTCATCGTCGTCACTGTAGTCGCCATCGTCTTCGTCCGAGTACTCTTCTTCGTCTTCATCCATTGGCTCA
TCGTCGTCTTCGGAGTCGCCGTAGTTGTAGTTCGGGTCATACTTGATGAACTCCATCACTAACGTAAGGATGCTCTGCACGTGTGGCGTGATTTCGTTAT
GGCATCGAATGACAAACGACTCAAACGCCTGGAAGCAGTTCTCACGGAGCTCGCTGGACGCTTCATTCTGCAGCGACTCGTCGTCTGGTTCACCGCAAAA
CTTCAGCAAGATCGGAATGATCGCGTTCAAGTGCTGTCCCAGACGGTGGCCCGCAGTGCGTGACAGCGTACCGATCGTCTGGATAAACGTGCGCACATCG
ACGGAGCCGCTCGACGCTTCGATTCCCTTGATCAGGTGCTCGACAAGACGCGTCAGCAACGCATCAGACGCCATCACGCCCAGCGATCCAACACACGCAG
TCGCACGCTTGCGCACGAGAGGTGACACGTCGTTCAGCTGCGTGATCAAGATGTTCATAATCGTGTCATGCTCCGTCGCGATGTCGTGGCCGAAGCGACG
CAACAGGTCCGTCAAAATATCAAGGGTCTCCGACTTCACTGCCTGGTCTTTGTCTTGACCAAGACCCTTCAGGAGACGAGCACAGAGCCCCGAGGCAATA
GCCGCGCCAGTCTTCGTCGAGACGTCCGTGAGAATCGTCTTCAGTCCAATCGAGTAAATATCGCGCAGCTCAGACTTTCCGTTCAGGATAAGATCGCTCA
GCTTCGCGCAGATGTCGGCCACCTGCGTTTCCTGCACTTTGGTCACCAAGATGCCCAGACTGACCAGTACGAAGCATACGAGTTAGCTTTACTGTTGGTC
CCATGATCGCAAGCTTGAAAAGGGGAAAAAATACGCACCATTTCACAGCGATCGACTGCACGTCGTTCGACTTGTCGTCCAACTGCTTCAGCACCGCAGC
GCACACTCTGTAATAGCAAACGTGCAGATGGAAATGCGTCGCGCAGTTATATCCTCACAGTCAGCACAACAGCTAGTGAACGGCAAGGAAGACAATGTTG
CAACTTGGCGCGCACGTACTTTGGTTCAAAGTACGGACCCAGTTCGGTGTCCTTGTTGAGCTCGTTACAGAGGTCCGACGTCGCCATGTAGCGCTCATCC
TTGTCGAAATCCGTAGTCTAATGCCAGCAGCAGCAGCACATTGCATGGTGG