Description :
From Genome Similarity Track
Location :
Scaffold_1230:681- 9494
Transcript NameFunction/comments
Phyag_g9972hypothetical protein PHYSODRAFT_497872
Phyag_g9973hypothetical protein PHYSODRAFT_491102
Phyag_g9974hypothetical protein PHYSODRAFT_298682
Phyag_g9975hypothetical protein PHYSODRAFT_298682
Phyag_g9976hypothetical protein PHYSODRAFT_495691

Sequence
8813 bases(100 bases per row)
CTCACGCCAAAATCCAACCGCTTCAACACTGGAATTCTGGAGGTGGCGCTAAAGGGTGAGTATAAGGGCGAAGCGTTCGGAGACAAACGCGTGATGAAAG
TACGTTTGTGGTTTTGTTGATAAACCCTTGGAATCCGAAGTGACTCCTAAGCTTACTATTAATCTAGGGAATCGCCAAGTGCACGGAGGAGCTACCCAAT
CATCCAGACCTGCGCGATGCCAAGCCGTGGAACCACTCGGTCGAGCTGACGAAAACTGTTCGCAATGAACACGTACGTGGTTTCCTGCTTGCAGTGTGCT
CGGAGGAGTTCCGCTAATTGGTTTCAAAATGCAGTTTGCAGCATTGGAGGCAGCGCGACAGACCAATAGCGAAAAAAAGTGGCGACACATGGTCGGGGAT
AAAGACAACTACAAGAGCCCAGAACAGCTTTCAAAAGCGTTGCTAGAGCGCAAGCGCCAGGAGAAGCAGGGGCTCATCGCTGCAAAGTCTAACCAGCGCT
ACTAAAGCAGCAAACTAAAAAACTTCGAATGCCAAAACGGGCGACTTTTTGTAAGCCGTCGCTAGAGCTAAAGCATTTTCGATAACGATGTcgacgccag
ctcctcctgaATCTCTTGTGCAGTATGGGGAGCCGATCTTCACGGGCGAGACACTCGATCCGCCGAAGAAGGTCCCGGGGGTTGCCAATGCAGGCTCTTC
CTCGAAATCAATTACCGCCGCATCGGTAGCAGCGGCAGCTGAATCAAGCGGAGCAATAGCCAACGGCAAAGGCTCCGATGGCGTTGCTCGGGTCGAAGAC
ATCCTAAATGCCATCCTACCTCCGCAGTACGCTGCAATTAATCTTCGTTTAGTGCTGCCTGACGCTAACCTGCCACTGTTCTGCCTTTTGCAGGATGTGG
TCCGAGGAGAATTCGGGTTTCTGGCTTCGGTACGCGTCAAGCGTGCCATCGACTCGCTTCGACGTACTGAAATTACAAGAAGCTCTCGACGCCAAGCTAT
TGCAGCGTCAAGCCCGTGAAAGCGGTATCTGCCCTGTCCGAGAGGATCTGTACTCCCAAGCTTTCGACGAACTTATCCGTGAGGTGACGCTCAATTGCCC
GGAGAGAGGACTGTTGTTATTGCGTGTACGCGATGAACTGCGACTCACAACGGATGCCTACAAGACGCTCTACGACTCGAGTCTGACCTTCGGAGTTCGG
AAGCAACTGCAGGCTGAAGATGGTATGGGTGACCTCACGGGGCAGATCGCTAATCTACAGCGGGACAaggacgagagcgagagtAAAGTGGCCGAGTTCA
CCAACAAACTCGAAGTCATTGAGAAACGAGCAGCCGAACGCAAAGctctgcaggagaagaagttcaaagAGGAGCTTGATTTTCTAAAGTACCAAGGACA
GCATCTCGACGCCTTCCTCAAGTCTGCAGGGGGTGGCACCACGACAGGTACCAGCAAGTAAACAACGGATATTCGAGTACCAAGCATTGTAACGCTACGG
GAAGAGATGTTGATGCAATATCTTGAGGAAAACTTTGAATTAGTACTAACTTGCATTGCAACCTTTTCTACCGAGCTTACGTCGTGTCGTTTGCCCTGCC
ACTACTCGAAGCATGCTTCGATTGACTCATATCAGTAGCCATTTCAGTGAGAAGAGCATGCGCCGCCGTCACGTATTTCCTTTGCTCCTGGGTCACTTGG
CGGCGTACGTGCTGTCGTTGAACGTGTGGGAGCAAGAAACTTGCTACAAGTTCGCGCACCACGGTTTCATCGCTGTCCTGCTCGTTTTCAAGCTGTAGCA
CAATTCCGTCCGCGCCAGCACTGCGCACATGCAGCTCATGCAGTGCTTGGGCATGCGATTGCTCGGTCGCTACCTCTTCCAGTATATCGTCAACAAAGTC
CCGAGATGTTTCCTGGTGCACCTCCATCACACGTCGGAAGACCTCATCTTCACGCTCGCGCAACAAATCCTCCGCTTGACGCCGCcctccttcttccact
tcacGAACCCGCCGCTCTTCGGCCGCCTTGATGACGAAAGCCCGCATCTTCGCCACCTCGCGAGATCGAGACAGCTCCTTAGACAAGAAGTCGAGCATAT
CGGAGACAACTTCACCCTCCACCCGGGTTTTGGCTGCGTTGGCTACGCGGTCAATAGCCTCGTTCTCAGATCCCTCCAGGAGCGCGAACTCGTGGCGACG
TTGCAGTGAAAGCTGTTCGTCAGCTGCACGCAGTTCTGCAATGAGCTCAGCGCGTCTCTCTTTGGCCTCGAACATCATGTTTTGGACAGCTCGACCACGC
AGTAATTTTTGCAGTAAACGGACAGTATCTTCCACCTCGTGCCCCTGCGTGCCAGCGACGTGAGTTAAAGCGTAGTCGGGTGTTGGTGGACGGACAAGGG
TCTGCTGCTTTTGACTAGCCCGTCGAGAAAGCGGGCTGCTAGCATTCTGGCGAGACTTGGCAAGACCCCCTAGTGATGTGTCGTCGGTACTCTCCTTTTG
CTCCTTGCTTTTCTTGATGATAGACTCCATCTTGAGCAGGTGGGCCTCTATAGCCGCTTGCTTTCGTTCCTTGGCAGTGCGCCCGCTCTTCTCACGAGGT
TTGTATTTACCCGCTGCAGGTAGTAACATCCGTGCCGGTAGAGCACTTTCCAGCTCACGCAAAACATCCAACTGCAAGAACTGCGGCTTGCCGATGCCCG
ACTCAAGAACTTCAATCTTGCCAGCTTTGCCATTGCGTGTAATAGGAGCATACACTTGCGAGCCGAAGTTAGCGTACTCGGCAATGATGTCCCGCCCTCG
CTCAGGCCTTGATGCCCCGAATCCACGTTCCTTCTGCCTCTGAGCACGCTTCTTGGTCAGTTTCCGTAGTGCTGATACGCGCTCTTGTTGGATACTTTCT
AGTGCATTTTCCTTTTCGTGCAACAATCGCTGGCGAAGcgcttccagtcgctgctcCGAAAGGAATGCGTTCTCTTTCTCGCGTTCTGCAAGGGCTTGAA
TGAGCAGAGCAACACGTTGATCGTGGAACGCGTCGATCTCAGCTTCGCGATATGCCCACTCGCGAGTCTCCTGTATTTCCAGCATGGCCTTGCGCAGCAG
AAAGCTTGCTTCATCGGTCATAGGCGGCAGTGACGCTTCAAAGgcgcgcttcttgcggtTGCGCTCGATAAGTTCCAGCTCGGCCTGTCCAACTGGTAGC
TGCCCACGAGCATGGCTTAGCCCCGTGAGCGAGCCTATCTCGGGTGTTGTGCCACTGGCAGTCTTCTGGACGGTGTAGTCCGGTGTGTATGGGTCTGTCT
GTACCTCGGAGTCGCGGTAAGCGGTTTGGATGCCCACAGACCGCGTATCCCCATCTACTAGATCGGCAGCAACGTAGGAGGATGTCGAAGATTTTGCATT
TCGACTTTTGACTGGGGGCGGTGGCGCAGCATATACCGGAGCTAGTAACACTTCCGGCGGCTCTGCTTGTAGATGTGGCAGCACTGGTCTTCGATGAAAC
TTGACGCGCTCACTGCCGCTGACGAGATTACTACCCTCAGCCGGATTTTGGTTGTTGATAGTGCTGCTCGTACTCACAGGTTTGGATGACGATCGATAGA
CGCCCTTGCGGAACGAGCCGCCAGAGTTCGAGACCGTGTACACTGTGTCTACAGCGGACACAGAGCACGACGCGATTAGCTGTAGCTCGACAGACGCAAG
GCAGATGCACGGAGCTTACCATAGACAGGATCAAGTGCCCGGGATGGCACCGTCCGCGACATATTGCCGGAGCTGTGAAGCTCGACCCGTCGCTAGTTCA
AGTTCTGCGCGATGGGGGCAATCTTTTTTTCGGAGGTGTCGATGTCTACGTAAATAACTAGCGTAGCCAAGAAGCACCATGTACATTTTCACCCGACAGA
TACTCCATCGCACCAAATGTGCGCATGCACTACCCTCCTGCATAGATCTAGGACGACACAGTCTTGGCAAACTTGAGCGCGAGCTGTTTCGAGTGAGTCA
CGCAGTCCGCCAGTCCGATGCCGTAGAAGCTGTTGCCACCCAGGAACAGCCCTGGTGTGCTGCGTGCGGCCTGCTTCTTGatacgctgcagcgtctggcC
GTAGCCCACGTGGTACTGCGGGATTCCATTTGTAAGAGCCATCGCGCGCACGTAGTCAGGCTTGCGTGTGATACCGAGGTGTCGCTTTAAGGCGTCCAGA
GCGTTCCGCTCCAGTTCTCCTTCAGGCAACGATGCCACCTCACGGAAGTGTGCACCACCGCTCATGACGCTCAGACGCGTCTGCACCTTTCCTTCAGCGT
TTTGTACTGGGAAAGTGTTGGAGTCAAACACGACGCCGAGCACCTTTTCACGCTCAGCAGTGGGGATAAGGTACCCGAATCCGTCGGTAGGCAACACCTT
CTCATTGAATCCAACATGGACCATGCCCATGTCCACAAATTTAATCTCGTCCAAGGCTTCAGCCAAACCAGGCGCCGAATCCTTCACCACTGGAGCCAAA
TAGCAAGCCGGGATAGTAGAGAACACGTGCGAGGCCTTGATCGGTTCACAGATCTCCCCAGATTTGGAGTCCTTGCTCTCCACAACGAAACTCGGTCCCT
TCGCCGACGCGTTGTTGAGTCCGTGGACTTCGAGTCTCGTCACCTTCGTATTCAACTGAAGGTCTGCCATTGGATCGGCCTTTATGTTGTCTGCCAGCGC
GTCCATAAGCGTGCTCATGCCCTCAGTGAAGCTCACACTCACCGACTTTTCGTGCTTTTTGATAAAATCCGACTTCTTGGTGCCATCAAGCAGTGTGTCg
tctgcgccagcgcctccaagCAGCATCCCCTTCACCACCGATCCATACTTCCTCTCCAGATCCACTAGCATGGGGAAGCACGCGCGCATCGAGAGTTTCC
TGATGTCTCCGCCAAAGATGCCCGAAGCCATGGGGTCTAGCAGCCTTTCAGCCACCACGGGACTGAACCTCCTGGCCATGAACTTGTACACCGACTCGTC
CTCCATCGCTCCTGGTTTGACGaacagctcgtgcagcgccgccCTCGCCACCTCAAGCGACAGCGGCCattgcagcgcctccagcagcgaactcggcacc
ttctccaccttcccGTGGCGCAGGATGTAGCGCGCTTGAGCTGCCGGGTCCACCGCCTGCATCtggtcctgcagctgcagttgctccACCAAACGCAGCA
TCTCAGCGCCGTTGCGCGACGGTCGGAAGCCTCTCGGTCCCTCTTCGAACAGGAATCCCTCGCGCTTGGCTGTGTGCACCCAACCGCCGGAGACGGAGCT
AGCGTCCAGCACACGGATGCGTGTGGCGTCGGCTGCAGCCTTGGGCAGCGCCTGGCGCAGGAAATAGGCCAGCGTCAGGCCCGAGATGCCGCcgcccagc
accaccacgtctCGAGCTGCCATCGCTTGCAGGCAGGGGGGTGGCAGGATATCTGGACTTCCGGATGCAGTATGGACACGCTGTTCCGAGGCCAAATGCA
GCTAATATTAACCAATTAAATGGGGAAGTTCAAGTCCTTACGGCGCCtgcaccttcttgcccttgaagaGCCCACCGAAGCCACCCGCCGTCTTGATGCT
GTCGCCGTTGGGCGCGAGGCCCTCGCTCtccgccttctgctgcttggcgcggcgctcgagctcctgcagccGCGCCTCCAGCTGGTCGTACGTGCCCTTG
GCCACGCCGCGCAGACGCTTCTGCAGGATGATGGCCGACACGATGAGCGGCAGCAGGAAAAGACTCAGGAACAGCGCACACAGCGAGATGGCCAGCGTCG
TGCCCAGCACGCTGTTGCAGAGCGACtcgttgatggcgtcgaacGACAGGTTGGCCCACGAGCagtcgctcgagcagcgagcCTGCTCCACAGACGTCAG
CAGGTTGCGCACAGAGCCCTTGTCGCCCAGCATCGTCGCAAGCGGACCGGTCTTGAGAGCGGTGATCTTGGTGAAGTAGTTGGTGGCGAACTCGCTGATG
GAGACCGAGTAGTTCCACTGGTCCGGGAAGTTCTTGCCCGTATCGCCCAGAAGCGCCTCGCGCATTTCATCCATCATTGTCCCCGCCTTGTCGAACGCCA
CCAGGTACTCGTAGGCTGCATTGAAGGCGACCTCGCAGTTAGCCTTAACCTGGCTCTGGGAAGACTTGGAGTTGCAAACACCTTTCATGTAGCACTCAGG
GAGCTCGTCGCTGGTCTTGTTGGTACAGTTGTAAGACGTGGACAACTCGTTGTACGCCAGCCACGGCGTCAGCACGTTTTCGGTCGTGAACTTCACGGAT
GGCGTCCTACCCGCAGTCGTGACTGTCGTAGTCACCTTGGACACGAGGCTGCGCGCGCGTGTCGAGTTGTAGTTGAAGTCAGCAATATCATAGTTTTGAA
CGATCGAGCCATAGTTCGTGATGACGGTCTCCAAGCTCGTCGTATCTGCAGCCTGGAGAACAGCGTACTCGTCTTCTACATTACATGAGAAGGACAACGG
GGTGTCGAGTCCCAGCGGCGTTAgaacgctgctgccattgaaACAAGCATTCGCCATAGCGGACATCTGTGTCGACGCGTATGGGGACATatcttcatgc
agcagcttcatgtaTTCGCACGAGTCGTACCACACGGctccgacagcaagaagcgatgCTGACAggacgaagctcagcacACACACCAGCACGCCCAGTG
CCCAGCTCACATGCAGCAAGTGCACCCACTgcgttgtcttcgtcgtacaAGCGTTCTTGACAATAGCGATAATGCCCAAAATCGACGCGATCAttccgaa
gaagaaaacgcacACCACAAGCGCGCTGCGCGAGAACGACAAGTTGTTGAAAGTACTTGTGAGCACGTCCACAACATCCATGGAGCTGTTCATCGATGCA
CCCAAAGCAGTCATGTCCCGTACCGCCGTGCGCAGACTCGAATCGAGGGTGCTGTCTCCGGTCACAAGTGCGCTTAGCAGCAAGCTTACCGCGTCGCCAA
CCACGTCGCTGCTAGCTGAaatggcggcggcagtgTTATTTACGAAGAACGTGACAGGGGAGCCGCAAACTCTATCGGGGCATGCCAAGCAAAACGTCTC
ACTTGTCGCGGGGTcgcacgtcgacgacggaaATGCTCCGTGGTTGTAGTAAATGCTGCCGAAATCTGCGATCATATTTCTGAGTGTAGCACCATCCGTA
GCAATCCAGTTCGAATTCTTGAGCTGCGTGTTCACCGCCTTCGACGCTATGCTGAgctcggtggtggcgttgctaAGGGGAACAAGCAGGTTGCCCACAA
AGATATTCGCGTTCTCCAAAGTGGCCTTCAGCGAGTACAGCACGTCTTCGACGCCATCCGAGATGTTCGTGTTTAGCGCTGCAGTGACGACCATGCAAAT
GAAGACTGCCAGCGAGCACACGAGGAACGTGAGTGTAGGAATGATGATATCGCATCGCGAGTAGCCTTTCTCATTCGGCTCGCGGCCGCCACAGCGGTTG
AACACGCACCGGAGCACCACAAAGCCAATGCAGCTCAACGCCGTGAGCACCCCCATGACCGTGCCAGGAGCAACAAAAGGTGCTAACGAGCTGGGGTAGC
CTGACGACATCCACTTGGTCGCAATCGTAACATCTGCATCCGTGAAAAGCTGGCGGCGGGCTGCCGTTCCATTGGGCACAACGTCATCCCACTTGCAGTT
GCTCCTGCGCTCACACTTCCCCTTGCTGTTGCACGAGTCCGTGTCCAGCATCAACACACACTTGCCGTCGATGTCGCGCACCGCATCGCTGCTAGAGGAG
TCCACACagcgctccagctccgctGCCGACGACGATTTCACGCAGATGTACGTAGTGAAGCTTGCCAGCGACTGCTTGTACCAGTTTTCGCTCTTTTTGC
GCATCCCTGACATCGCGGTATTGCCTGCGACGGCACTCAACTTGAGTGCGCTCTGACGCGCCGTGTTGTACgcaacgacggcatcgtTCTCGTCCGCATT
GATCTGCGCAGACGTCATGCCAGTCGGTGACACGTAGTTGGTGTTGTCTGCTGTGCGCACGGGGCACGTGGCCTCCCACGCCAGGTCCGCTGCGCTCGAG
CACGTGGTCGGCCACGAGGTCGTCCCTACCGCTGGGCTCCCGCCCGTCGTcgcgctcagcagcagcagcgcgaggccCTCCCGACAGCGCATCCTGGCAG
CCGCTTGGTCGCTGCTACTTCGCCGCCCGCTGGCTGAATTCGAGAATGAGCACTGCAATGGCCAAAACGAGTGTCCATGCGATCCTGCGCAACGGAACCA
ACGGAACTCGGCGGCGTCCGTCCAGGGTGGGGTGCAGCTCAATGCGTGGAGTGCACCCCCACCAACTCACAGCTCTAGGGcagacgccgccttcttgccg
cgcttTGGCGTGGGCGTTCccctcgcgtcgaagcgctgttTGACCACGACCGCGGAGCAGCCGTAGCGTCGCTTCACTTGGCGCCTGTCCTCCTTCGAGA
GCTCGCCAGTGCGCAACGCCGAGCTCCCGATGGACTGGAAGCaggcgagcagctcctcggtGGAGGGGTTGTTCCAACCTCGCTTGTACTCTTGCCCCCG
CGATCATCTTCCCGCCGTCGCGAGGCGATTCCTGGTCGTACTTTACTCTCACGCGCGCGTTGGAGGCACGCGGTAGATAGTTGTCTTGGTTTCGTATCGC
TGGCCGCCAGGAACTGTGCAAACTGTGCCAGCTTCATGATGTGTTAGCTAGCACAAACGGGTCTTCCAGAATCGCCACTGTCTCTCAAACATGGtcagct
gctgaagcttggC