Description :
From Genome Similarity Track
Location :
Scaffold_2610:681- 4013
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_2610-snap-gene-0.1Telomerase catalytic subunit

Sequence
3332 bases(100 bases per row)
AAGCGAACTGCAGCGAGGCATAGCATCTGAAACATATTCACCTGCGGACGCAACCATGGTTGGACCACACTGTTAGAAACCTCCTCTGAGCGCGTTGATG
ACGGGTGGGTATTTGTTCGTACCTGGATGGTCTCCTTCAAGAGATACGCGGGGTCAAAGTAGAGCGGATGCCATCGCTGTCGAATCGATGACAGCACTTT
GTTCACGAAGAAGTCCTGAAGCGCCTTCGTCTCATCGAACGGGATGGATGCTTGTGTCATGGAGCTGCCTCATTTCGCGCAACAAAGTTAGCATCCCAGT
AAACAATACACTCGTTATGTGTCTCTCACACCAATACATCAACACTCATTATCACGTACTTTTCGTAGTTGACGAGCACTTGGAGGTGAACAGGGTCGAT
GAGCATTCCACACCAGCCGAGCCTTGAGTCGTTTGGGTCTTGATCAAATCTCGGGATGGCTTGGGGAAGATTCCTGTTAGTTTGCACGAACACGTCGAAG
TTGACGCGGCTCTTTGCAAAGTTGACAGAGGAGCCGTAGTCCGCGTTGCCTTCGTGCATGAGCTTTGCGAACGCCTGTGCGCGCTTTAGATTCGTACTGA
CGAACAGGAAATCGTCGGTGTAGCGCATCAGCTCTTCATGATGACAAGAACACCTGGAGTCGCCTGCAAGTGGCCGGTGGAACTTGCCGAGGTGTCGCCA
AATCACTTTCCGCTCAAAGTCTGCATAGTAAAGATTGCAGAGAAGCGTGGAGAGCACCGAGCCTTGAGGAATCCCTTCTTTCTGCACGAACTCCTGGTCG
TCGATTTGCACGACGTTCGTCAGGAGATGCTCTTTCAGCAAGCTGAGAAGCTTGGCTTTCGGCAGGTAGTCGTACAGCACGCCATCGAGGAAAACACCAT
TCCGCTTCTTGGATTTCACCACGAGTTCGTCAAAACCCTGCAGGTCGCCAGATCGGAATGCTGGGCGCTCCATTTTGAAAATCAGCGTCGTCTTCGGTTT
TCGTCGTGATCCCCTATGGCTGCCCTTGTTTGCGAGGTTGCTTCGCTGGTACACCCAGTGCTTCCGAATCAAGTACTCATCTTCCAGCACAGTCTTCTTG
AGCAATCGATACAGCTTGCGAGGGCGAATGGTGTCAAAACACCGCTCGATGTCCACGGATACACAATACAGCGAAGGTCCACGTGTACCTTGAGGGTAGT
CGTTGCAGCTTGTACAGGATGCGATCTCATTAAAGAGCGGCTTGATCCGCTGGTAGATTTCGTCCATACTTCGCACAGTTGAGCCGAGAAGGTGCTTCGC
TTGGCGGTCCGCTTCAAAGAGCAGCACACGATGCAGAGGCTCTAGCGACTTGTTGACCGACCGCTGGTTGCGATCAACTGGGGACGAGAGGTTCATCAGC
GGGCGAATGCCACTCACTTTTGGAAGCAAGCGAAGACGAGAGGTCGCTAGTTGGCGAGGCATTTCTGGTTCAGTGGTGCTGTCGACTAGCTGCAAAACGC
CAGAACTCAAGTCGTGCACAGCCACGTTGCTACAAACACGCACCAGATTGAGAATCCGCAATACTTATGACGGCAGTAAGAGAAATATCAATTTAGCAAC
ACAAACCTGATAGCATCCCACACTTCGCGCTGGTAGAACACGATCTCGTTTGACGCGCCTTCGCGCTCCGTGATGTAGAAGAGATTGCGCATGAAAGGGA
ACACAAGACTTTTTAAAAGCCATGTAATGAGTTCTTGGAAAAGTTCTTGGCGTTTTAGCAACTCGTTCGGAGGACTGCGAATGAGAATGGTGATAATCAG
TATCACGTGCCGCATGTACGTATTTGCTGGGTAAGCTGGAGAATACACTGTGAAACGTACCAGTTTGACGGATTTTGCTGAGTGTTCATCCACTTCACAC
CTTTCACTTGCATCTCCTTACAGCACTACACGTACATAGAACAAGTCAGCAACGCAACGATACCTTCTCGCCGTTTTGTCCCCCGAAATCGCTCCGCCTT
ACCTCTTTCAGCGAGATGACATCGTACTTCCGAGAGGTTACCAACTTTTGGAGTAGGTTCTTGACGCATTTCCAGTTTTTCACATTGCTCGCTCCCCAGA
TCTCCTTCGGAACCAACCGAGCCACAAACTTTCGAAGCAGGCGAAAAACGACTTTCTTGGAGACCACGATTTCCCCCAAATGAGAGATCTCGTCACGATG
CTCTCGCAGTTTCGACAGACTGCTGTTTGAGGTGTCGACAGTACTCTCACCACTGAGCAGAAACGGTTGATTTGTAGGTCGTCGTGTTCTCTTTCTTGAG
GTTGAGTCTTGTGGCTGCAAAGGTTCAGATGATGCAGACGCACACGATCGAGACTCGATCGCTTGTTCTCGTCGCTTGCGCTTCCTCTCAACCTGCACAC
TGTCACTCTCTTCTTGACTTAAATACTCGCTCTCCAGTGCTTTAGCTCCCATGGCGCAAATCTCTCCCAGATCGAAGGACTGCAACTGACTCGGCGAGTT
GGCTGCAATTGGCTTCAGCTTCTGGTTCTCGTGCATGAACTTTCTGAATTTTGGTGGAACTCGCAGCAGACTCTTCACCAGCGCTTCCAGATCCAAGTCG
CGAAAGCGTGTGATCAGCGACTGAATGATCGGTATGACGTTGATGAGTCGCTTTGGCAACCGCTTGCTCTGATTTCCGTTCGGGTCGTCTTGATGGAAAA
TGGTGCGGATGAGTCGACCTACAACTACTTTGGAGATCTCCGCGCTCTTTGCTGCCTTCACAAGCTCATGCGATCCGGAGAAGATGCGCTTCTTGCGAAA
GTGCCGCGCATAAAGCACTTGATTGATCGATATCGCGCCGTCCTTCATCAGGAAGTCTCGCCCACTTAGCTTGCCGTTCTTGATGAGACCAGCTGCTGGC
TGTGGTTGTTTGTTGTTGCCATTGCTGAATGACGACGGTGCCAGAGAACTGTGGCGCAAACTCTTGCCAGCTACCTGCACAAGTGAACCAAATCAAAACA
CATTCGCAGAGATGAGCCCTTGAGATCTTAGTGAACAACAGTCCCCAAAGTTACCTGGATGAACGAATGTTTGGATTCCTGGAGCTCCACGATCACGACG
TAGTTCATTAGCAAATGAATCATCAGGTCGTCGCCAATTACTGCATGGAGCGTTTGCCACGCTGGCGATTTCTTGAGCAACGCCACCAGCGTGTTCGGGT
AGCAGCACATGATGCCGTTCGACGACGTGACACGGTGACCCGACGGACCAGGCGCAGCTTCGCGATATCCAAGCGTGAGGATATTCGTGTCATCCGAGTC
CGATCGCTTTCGGATCAGCAGTCGCTGCATAA