Description :
From Genome Similarity Track
Location :
Scaffold_2186:681- 3445
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_2186-snap-gene-0.0Voltage-gated Ion Channel (VIC) Superfamily

Sequence
2764 bases(100 bases per row)
CGCTCTGGATCAACGGAGTTTCTCTTCTCCGAGATTCAAAACGCATTTGATCCAAGCTCAAGCTTCATCACGACCTGGCAGCAGCTCATCCTGGGATGCA
TTCTCTACGAGCTTCTTTTGATCCCCTACATGGCGACGTTCCACCCGTACGATTTGACGTCGTCAGTCCAACACGACCTGCTGGGGATGTACGTATGTGA
GCTCGTGTTTTGTGTGGATATTTATGTGCAACTGAACACAGGCTACTACGAAGACGGCAATGTGCTCCGAGACACCCGAAAATCAAGGATCAAGTATTTG
AAGTCAGTTGGATTCGTGTTGGATGTGCTGGCGCTGCCACCACTTTCACTGCTGCCAGTGAACATGCATCTCTCCGTGGTATTTCTCGAATTCCACAAAC
TCAGTCGATTACGGAGGCTCCCACAGCTCATCTCGAATCTGGACAATATATACGCTCGCTATTTCGAGCCACTGAAGCTTGCCAAGGTCTTGGGCATCAC
CATTGCCGTGTCCCATCTCGTTGCATGCGGGCGGTTTACGTTTGGTTATGACTCCCACCATCACGATCATTGGCTGCCTCAAGTTCATGAGCACGAACAA
AGTGGCCGAAGCAAGTATTTGATGTCGCTTTTTTGGGCATTTGGGCTTTTGACGGGGCTGTTTGAAGGAGAACTGCCTCACACGAATGCCGAATTCGCAT
TCACGATTTTCGTTGCGCTGTGTGGATTCTCGCTGTTCACGTATCTGTGTGCAACGTTTTTCATGCTCTCCAAGTGCGAAAGTGGCGATTCAGAGACCTC
AGAAGCGCGTGTGAATCAGTTCAAGCACATTTTGGCGTTCCATCGAGTCCCAGAAAAGTTGCAGGAGCAAGCAGTCGAATATTTGAAGCGCTACTACACT
CAAGCAGAAGCAAATGATCGTGAGGCTGCAAGATTGCTGTGTCCATCTATTTCGACTGACATCCAGATAGAGCTACTGAGGGATACGGTCGCTCAGATTC
CAGTCTTCGAGGGATGCGACTCGCATTTTATTAACGCGGTGACGAGTTTGCTGGAGTTGATTTCATGCCCTGCGCATTTCGTCTTATTCCAAACTGGAGA
TCATGGTGATGCAATGTACGTGGTGAGCTCTGGGGTTCTCTATACTGTTGTAAACGGAATCAAAGTGCGCGAGCTTCGCAAAGGAAGCTTTTTTGGTGAG
GTTGCGGTGTTTGCAAAGCTTCCACGCTCTGCAACGATGATGACCACTACGTACAGTACGCTGTATCGGCTCTCGCGTTTTCATGCAGAGAAGTTGTTGG
AAGGATACCCTCGATACGCGCAGCTGATCTCACAAACTGTGAACAAGATGCTTCAAGAAGCACAGACAAACGAAGAAGATAAAATCAGCGAAATTGCAAG
CGCTGGAGCCATTCAAGTGCAAAAAAAGAAAAAGAAGTCGTCGCTCTTACAGGTGGTTGGTCTCAAAACAGAGCAGCCTGTTTGGAGAAGCAAGAAATCT
CTTACACAGGTAAAGCCTGATTTAATACCCCCCTCATCCAGTATAGAGTCAGCAACATCCTTGAGATCTAGCCAACCAGCACACCGAATAGTCCCGATTG
AGTCCATATCATCCCAGTCGAAGGTGGCTGAAGTGCCAAATACTGAAAATCCGTTGTCTACCAATGGTGGAAGTTTTCAATTCCGTCACTCATCAGGAAA
AGTGAGTCCTGCAATAAGAGATCTTACTCCACCATTGTCACAGAGAAGCGGGCACCAAATGCTTACGGCAAGTGGGTCCTTGTTTCGCGAGAGTAAACAG
AAGCTGGAGAGTTTTCGCGACAGTTTTTTTCGAAGAAGCAGAATCAGCCCAAGTGATGAAAAGCCTCAAGATGTGATTCGAGGTTTCTATGATCGGCTTC
CTCAGATAGCCCCTCCGTCACCTCCAGGCAAGCATTGGTGGGCTCGCTTTTTACTCAAAAGATGCATTGATGCTGAATCCCGAGCGCGCATGGTGTGGAT
CTTGTGCCTACAGTTGATTCTGTGCTACAACTGGATTGTCATCCCGTTGCAGCTCGCGTTCCCGCTACTTGACGACAAAATTGTTCCAATCCTGATTTTG
AATTTCGCAGTTGATGTGATACAATGGGTGGACATCTACTTGAGTCTCAATCTTTCGTATTCCATCAACTCAGAGAAGATTTTTGATCCAGTGCGAAGTG
CTGAACGTTACCTCAAAAGCTGGAGCTTCGTCATGGATATTTGCTGCATATGGCCGTATGCGATCTTCAAGCCATCTCTGAGCAGCACGACTGCCATTCG
TATTCCGCAATTGCTGCGAGTTTGGCGTTTGAAAGGACATTTCAGCGAAGTGGAGAACTTTATGCTCATCAACAGTCGGAAGAGGCTCATACTTTTCGGA
CTCGTCTTACTCATGCTGTATCACGTAGTGGCATGCTTGCACTTTAGCATCACACACTGGGAAGGATTCAGCCACAAAATTGACGCGTGGATTCCATCAG
ACGACATTTACATGCGCCAGATAAATGGGTCATACTTTGAGGATGTCGACGGATTCATGTATGCGGCATACAGCGCGAAAGTGCAACGAACTCGAGCGAT
GCAATACTTCCGGTCCCTTTACTATGCCACAAACGTTCTTGCAGCTTTGGGGCGCACCATGGAGCCAGACAGTGAGCGGCAGTACGTCGCTGCATTGCTA
TTCATGCTCAGTGGATTTTTGATCACAGCGATCGTGGTTGATAACGTTCAGAAGCGATTCACGG