Description :
From Genome Similarity Track
Location :
Scaffold_522:681- 3124
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_522-snap-gene-0.5Conserved gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_522-snap-gene-0.6Conserved gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_522-snap-gene-0.7Conserved gene of unknown function

Sequence
2443 bases(100 bases per row)
TTCTTACAGGCATTCGAATATCTGGGGCCGCCATTAGTGTTGGTGATTTGCGTATCGATTCTGTGGACGACCGGCCTGATGGTGCTGAACCTCGCCCCAA
ATTATACGGCAAATTACCTCATGGACACAGCAGAGTTCGATGATGGCGTGTTCTGGCTCATTATCGCCCAAACTTTGCCACTACGCATCACCACCGCCTT
TGGTTTGCCACTGATTATTTTAGGCTATTGCTTTGTGTTGCTGAAGATGACGGTCTTGCGAAATCGAGAATCTCGGCTGGCTGTCAGCCTCTCAAAGCTC
ACGCGCGCAATATTTCGAGATGGTAGTTCGCGGCAACGAGTTCTCCAGTCGTGGAGGAAGCTAACAGAATATCAGGGCGCGAATCGAAAGCGATGGGTGA
GTCATGCGAACGTTGCTTGATTGGGGTACGCTGGTGTGGATGCAAGTCTAAACAAACGTTTGGTATGTAGAATGTATGGCTGAAAATCGTTGACTTTGTC
TTCCAGACAATGACATTGTATCAAATCCTTGAAGCTGGCTTCCCTGAGGTGCTGGCGTACACGTATGCGGTTCTGATCACAACCAACGCGATATCATGTG
TACTCGCCATTTTGAACCACTCAAGAATATCAGCATTTGGTGAAGTTCTCATTGATACAATGTACGTCATCGATGACAGCATCAAACTCTGTTTTGGCTA
AAAATGCTGCTGTGTTTATACTCCATGGCAGGTTTGACATGGCAATGGCTGTTGGCACACCGGTCATTCCCCTCTTCTACAGCTACTCCAATTTCCATTT
CGATCGAGAAGTGTGCCGTATCAACCTAGAAATGATTCCAACGGGGGGCATTTGAACGTCAAGCTCGATTGGCAGCAGATCCGATTCAAGTCACTCTATT
TTTGAGATGTTTCAATGGACTGCGGATTTGGGGCATTGTGGACTATGTTCTTCGTATCGGTATGAATCTGTCGTTTTGCTATCGGCTCAAGCGTGTCGTC
GAAATCAAAATACAGCAACGCAGACGCGACTCAGTAGCGCATGGAGGGATTGTCGAGAACGCGTTGCATCATCATCATCAGAAGCCTGTGCTGAAATGGA
TGGCTGTACCGTTCGTCATTTTTGCATTTCTTGTAGTCTTTTACACCCACAAGGGTATAAAATCTTCCAAAGAGCGGTGCGGTGCCTATCCAGAATGTGT
AGCCTATGCACTCAGGGTCACAGCCAATTCGCACTGTCCATGTCTGGCAGTAATCGATGTTGACCCAGCTCCAAAGACCTACCAAGAATGGATTCATCCG
CCTGATGCGACAGAAAAAGTGAGAGCGCTGGCTGCGTCGGGGGACCTGCAGATGCTTCAGTTGATTAACCGGCAGCTTGTACGCTTTCCAGAAGAGTTGC
GCCGTTGCGCAGGAATGCGCCACATGTACGTAATCTGATCAATGGATTTCGACTTGACGTCCTGGAAATCATTAATGTTTAACGTCCGCGTGTCACCAGT
GCACTGATTTATACGGCGGTCGAAACGCTTCCGTCATGGGTAGAAGATTTTACGGCTCTGGAGTTTATGTAAGTGATCTACCTGAGACTACATGAAATGA
AAACGAAATAGAGGCAATCTAACCAATGATGAACTTGGTTCTCAACGCATCAAGTCATGTGGCAGGGCTACCGACAAGAGCATCTATGCTTCATCTTCCT
GAGAGCCTGTTTGCAAAAATGTCGGCACTCACGTTCATTCACCTTGCGTCTTACGTCTTGCTGGATCTTCCGTTGTTTGACGGGTTGTCGAATCTCAAAT
CTATAACCCTCGCTGGGATCCAAGGGCTAAAGCAGTTACCGTCGCTATCTCCGCTTCGGCAACTTGAGCGGCTAGAGCTCCTTCATCTTGCCGACATGAC
GGAGTTCCCAATGTCTGCTACTTTGACGGAGCTTTCCTATCTGGTAGTACGAGATATTCCAGCTTGTTGCAACGGATGGATTAGGGCGTGTGATCTTTCT
CAATGTGCGGCATCAGCGTGCGTGGCAAACAGTTCCGCATTAGACACTGGCACTGCAAGTGTTATTCGGCGCTTTAACACCACGGCTTGCTCTGATGGTG
GATTTCCAGCCTTCATAGTCGACACGATCAACTCGCCAGCACCAAACAATGCGTCAAACAGCTCATTAGACCAAGGTAACGGATTCATACAGCCCAGCAT
CCAAGATCAAGAAATATCCAAAGCCGATGTTGACGTATGCGAAGGTATTTTGTATCGCAAATGTGACAAAACCATTGGTGGTGAGTCACGTGGTACAAGC
AGGGATGCGGCGATATGCAATAGCGACAAAATGCAAGTGATTGCGTGCACAATTAATCCTTCGAGCGTGTCGGTCCGAAAGATGCAGATCCTTCACCATG
CAGGACAACCGTGCGACCCAGTCGAGGAGCGATGGCTGGGGTG