Description :
From Genome Similarity Track
Location :
Scaffold_3139:681- 2462
Sequence
1781 bases(100 bases per row)
AATTGTTGATTTGGGTGGATCTGTTTACCGGATACGTGATAGCCAAAGCCAGTGCGTCTAGAACTACGCAAACTATTGCCGAATCGTACGAGGACTGCGT
TTTCCGAAGATTTGGGGCTAGTGAGATGGTTAGACATGATCGGGAGCCAGGTTTTATGTCTGATTTCTTTCGAGCTTTCAACCGGATCCTGAGGCAGAGA
CAGCGAGCAACCATGGCATATCGTCCCCAAGCTAACGGGTCGGCCGAGCGCATGGTGCAGACGATCACGAGGGCACTCAAGATGTATGTCCAGGATTTGG
ATCAGAGGGATTGGGATGAATACGCAGAACGACTCCCCTTCGCGATGAATACCGCCCAAGACAGGATCCGGGGTGATACCCCATTTTACTTGGTACATGG
GTGGAATCCCAAATCCACCCTAGAAGCAGCCATTCCAGTGTGTAGCACCAAGAAGAGGAACCGAGATCCAAGGCGATGGCGGTACCAAGTCCAGAAATAC
TACCGGCAAGCCAGATCCCAAGTGAACGAACGGCTGCGGAGTGCGATACAGGATCGAGCGGATCGACCCAACGAAGACGCCCGTCCACATCAAATTCAAG
TGGGATCGCAGGTGTGGCTTTATTTGGATCGAGTGAAAGAAGGGTACGCACGCAAATTGGCCCATCTATGGCATGGACCGTTCCGGGTGAGCGAGAAGAT
TGGAGAACACGCGGTAAAGCTGGAAACGGTAGGTACCGAATACCGCCTGTTCCCTGTGGTACACGTATCCAAGCTGAAGTTGGTCAAAGAATATCCCGGA
TCGGCCGCAGATCCGTCTTTCAGTGGATGTATCCGACCGCGTGGATTTCGACGAAGTCCTCCTACCGGAAGATAGTTGGAATGTGGATCTCGAAGACGAC
GAGTTCGAAGTCGAGAGGATCACCGATATGAGGTCGGGGAAGCGAACTAGATACGGACGGATTTACCGTGAATTTCTGGTGTATTGGCGTGGATATGACG
AACCCAGTTGGGTAGACGAGGCAGATCTGAACTGTGGAGCATTACTCTATGATTTCTTGCGGGAACGTACGAATCGGGACAGATTCGGCTTGATGCAGTA
TCATGAAGAAGAGTAGGAAGGGGATCCATGGATGTGTGTTGGTCATGTCGATGGGAGAATGAAGAAGGACCCACAGGAGGGGTGTGGGTCGTGAGGAGGA
GGATCGCAGATGTGAGTTGGTCACATCGGAAAGAAAGAGAAGACGAATCCACAGGGGAAGGGTGGATTAGGAGGAAGGAGTGAATGGTTATGCATAAGAA
TGACGTTTTACGTGCGAGGAGTCCTGTTTGATCTCAAGCACGAGCTTTCAAGGGCCCCTACTATACTGACCCAATTGATCCAGGGTCATTGGCGCTAGAT
CCGGATGCAATCCAGGCGCAGATCCAACCGGATCCGGGATCCCGCCCAGATCCAGGTGTACACTGAAAGGGTGGATCCCGCCCAGATCCAGGTGTACGCT
GAAATGGTGGATCCAGCCCAGCTCCAGGTGCACACTGAAAGGGTGGATCAAGACCAGATCCAGGTGTACACTGAAAGGGTGGATCCCGCCCAGATCCAGG
TGTACACTGAAAGGGTGGATCCTGCCCAGATCCAGGTGTACACTGAAAGGCCCGGACTAGATTTCTCAACCAACGAGGGAATGTTATGGACATATTCAAG
TAAGAGAGTGTGGATTATGATAGCTTATGCGAAGGGTTAGCTCGACCCAGTTTCCAACCGCTAGTTACTGCTACGAAACGA