Description :
From Genome Similarity Track
Location :
Scaffold_3:68099- 69928
Sequence
1829 bases(100 bases per row)
CGGCGTCGGACATAGCTGCCCGATGCCCCTGAGTCAATTAAAATCGACCACGGCTCTTCAAAGCCCTTAACTGTTGCCAAGGCAACCAACAAGCCTGACT
TGTATTCACGTTTCGTGGCAACGTCCACGTGATCGTGTGGGCTAAGCTCTGTTCAGCTCTACCTCCTAGATCCTCTACGATGCCTAGTTCCTTCCCAGTA
CGGCACCCCGCACCTACTGGGAGTCGACGTGTCCCGCGCCGTACCATGTTTCTGGTTTGGAGCGGTATTACGGCTCGGCCGATTCTGTCGTGGTTTTCGC
AGTGTACCGTTTAAAGCAAAGATGCCTTGTGCTTCTACACGTGAAATATCTACGGACATTACGTTGCTTTTTTACAGCTTGAAGATCGGCTTCTTCAAAA
TCCGAATGACTGAGATCCATGGTCTCAGCTCTATCAAGAGAATTCTGGTCATGTCAATTTTTACCGTAGCGAGCCGCTTTTAAAGTTAAACTCGGCGTCT
AACGCTATGTCCACAGCCCCCATAAAGGTCGAGGGATTTATACCTAGCGACCCCAGTATGAAGACCTTCCTTAAAAATGGTTACACAGACTTCCTCAGGG
AGAGGATTTTACTGCATAGCAACGAGAAGAGTTCTCAGCTCTTGAACATAGTCCCATAACACTTTTCTCCCCTTGTCGAGAGTATAAGAAGCGCGAACGC
ACTCGATATGCCTGATTAGGCAGTGCAAACATGCGAGACATGTGTCTCTTAAGCGAATCCTACATGGGAAACGCGGCGTCTACAGACGTATCACACGTCA
TAGCCCATTCTCTGACTCTGCCGCCAAGTTTTGATATGGCTAGGCCAACTTGCTGCTGCTCGGTTCGCAGCATAGCGGCGCTCAAATCTCCATTTCGACT
TCTCGAATCCAGAGGAGGAGGTTTCTCTCTCCTTCCCGTCAAACGTCTTTACGCTCAGAACAAGCGGGCGAGCCTTAGGATCTTCATCGGGCATAGGGAT
GTAACGAGTCGGCATAGCCGACGCCACATGGTCATGGACTTGCCCGATAAACGTGGCCTCAATTTTCATAAAAGCTTCCTGCCGTGCGTTGAGCACTTCC
GGGCCTTGAGCCACAATATGGTCGATTTGTTCGATCCCCATCACCGCTCTCAGCTTGTCAAGCGCAAGGAATTGAGCCTGAGAGAGATGAGCTAGGCTTT
CCATCTCAATAGAGGTTTCGTCGATTTGCGACTACGGTGTAGGATTTACTACGAGTGCTACCGAGTGTAGTGGAGCTACACAGCTCTTAGTCAGAGGAAG
ACTTACGACTCTAAAAGTCACTTTGTTCTACGGAACTAACCTCCTATTGGTTTAAAAAATCTTTAGCTCTTAGAACTAATCAACGAAGAATCGCAGAGTT
TTCACGCTCGTGGAGCTTCTAGTCCTGGTCCAGGGGACTAACACCGATTCCAAGAATCTTACGCACAAAGTGCTCTAGATTACTTGCCACAAGAAGGCTC
TTACCCTTTGCGATCTGCCGACGTCTAAACTAGACACGTGTTAACAATAGATCAAAAGGGGGACTGTTATTTCTTTCTAAGTTTTATCTGTAATAAACCT
CATTCAACTACCTAATACTAAGCTTAAACGAATTCTCAAAGTAATCCCTAGTATTCTAAAGATTGATGGATGGCACATCAATTTGTCATCAATGGATGAC
TGAGGTTATCAACCACATCAATTATCGCAGATAAACTCGGGATCGTATATCACATATACAAGGTATATCCGTTTATGGCGGTAACTGTCGTGTGACCCCG
TTACAGAGAGACACATTTGTAGTGCTGAC