Description :
From Genome Similarity Track
Location :
Scaffold_21:68088- 70048
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_21-fgenesh-gene-0.12Thioredoxin Clot
Pytve_DAOMBR484maker-pve_contig_21-snap-gene-0.46Conserved gene of unknown function

Sequence
1960 bases(100 bases per row)
ACACTGAAGGATCGGGCGAGATTGTGCCATTCGAAGATCGCCACGATGTCATCGCTGGCTACGACGCCACGCTTGAATACCTGCAGAAGTACTCGACTCC
AGAGGGCTCGAACGAGCAGCTCTTCCTCTTCTTCGTGTGCAGCGACGCGAACGGCACGGCTTTCGACTGGAAACCCATCTGTGCCGACGCCAAGAAGCTC
GTGTACGACGTGTTCGCCAAGTCTCCGTCTTCGAATCGGCTCGTCACCATCTACGCTGGTCCAGAGGAGGCCTGGAGAGGTCCAAACCTGCTCAAGGAGG
ACGACGACCTGCGGCTCAAGTCGATCCCGAGCGTCATGCGGTGGGATGGCGGCGCGCGCAACGCCAAGCGGTCGACGTACGGCATGATGATTGACGAGAC
TGTACTGTATGAGCCCTTCCTGCGTTACTTGTTCCGGAATACGGACAAGGTGGACCAGCGACTGGCTCACAAAGATGTAGGGTCCAAGGAGATCGTGACG
GTCAAGGGCTACGACGAATACAAGCGCTTCATGACCGAGTATCAGGACAACTCCACGCCATATCCGCTCTTCCTGATCCTCTACTCCGGTCGGTGGAAGT
CCAACAACCGGCTGTGGTGTCCCTTTTCGCGCCAGTCGGAGCTGCCGCTCGAGTACGCGTTCTATGCGTTCGCGCCGAGCGATTCGCGCTTCCTAATCGT
TGAAACGTTCGACCTGTACAAGCAGTGGAAGGATCCGGAGAACGCGTTCAAGAAGGACCCCGAGCTCGCGCCGAAGGGCGTCCCGTGGTTCTTCCGCGTG
TACCCGGAAGGCGGCGGCTACCTCCTGTATCAGCGCGTGAAGCAGCGCTTCTACATCCTCGAGGCGCTGCAATGGGTGTTTGAAGGGTCCACTTAAGAGC
AGCAGTGCCCACACACCAACACTAATGGTAATGCATCTATTTGTTCGTTCTGAGAGATCACCTACCTATTGAAATGCGAAACTCAACAAGCAGGTCAATC
GTTGCCGACCAATTTGCTGAGGAGGTGTCAGTTGACGGGGAGTGTACAGTTCATTTCTAAACGCCAGTTCAGGATTAGACATAGTGAAAGGCATAGAGTT
CCTCCAAGTCAGATCCAAAAGTGAAGCCTTTTAGAACTCATACGCCGTCCTATACCATAGTCGACCTACAATTGGCAAGCATTTCTAATCGACAGTTTGA
GTTTCTAAAAAGTCACGTCAGCGAATCACCACCTGGCACTCGCATGGCTCGACGACCCAGACCACCACACACTCCGAGAGCTCTCCGCCGACCATGAAGC
CGTCCCGCCGCCGCCGCGCCGCCAGGTCCCAAGGCGCGTGGACCCCGCGCCAGCTCTACTCGGCTGCGATCGGCGCGTTCATCGTGCTCTACTGGCTCTT
CCTGGCGCGCATGAGCCACTGGCAGCCCGCGTCCCCGGCGTCAGCGACAGTTATCGGAGACTTCAAACGCGCAGAGCCTTTCGGTGAACCAGAGCACGTC
AATGGCAACGAACCAACAGCGCGGAGCGTACAGGAAGGAGCTGCAAACGTCCAGGTGTTGGAGCAGCAGCCTGTCGACTCGAAGCTGTTGCGAGGAGCCG
ACCAACCTTCGTCGGACAACCTCACCAATGTCCCATCACGACCTGTAGACGACGCAGCTATTGCCCAAACAGAAGCTCCAGAAGCGACGTCTGTTGCTGA
GACTGCTGCTGTGAAGACTGTCGGTCCGCCTGAAGAACCTGTGGTCCCGTTTGAGCAGCGACACGATGTTGTCTCGGGGTACGACGCCACACTGGCGTAC
TTGAAGGCGTACTCGACACCAGCGGGATCGAACGAGGAGCTTTTCCTCTTTTTTGTATGTAGCGACGAGGATGGCCGCGAGTTCGACTGGCGACGACTGT
GCGCTGAAGCCAAGGCCAAGGTGTACGACGTGTTTGCCAAGGCGCCAGCTTCGAGTCGGC