Description :
From Genome Similarity Track
Location :
contig_120:68085- 70118
Transcript NameFunction/comments
g11380.t1hypothetical protein

Sequence
2033 bases(100 bases per row)
AGGTGGATCTTTGTTCTCCCGTAGATGGAACAACCCGTGTACCGAATTGTGCTCGGTCCACATTGAGGGGCCGGTGACTTTTCGAAGAACAGACTCGAGG
CCATGAAATACCTGTGGAACATGGCCAATACCTGTTCTCGTGGAATGCAATACTACTCGTGGCTCATGAGCGAGGTATACGTCCATTTCTCGGATGAAGG
ATCACAAACGGTCGCAACTGAGATCGCCAACGCCTGGACAGACGACAGAATCTCAGGATTTAGCTTCGACGTGCACTGGGCGCACATCTACTGCGTGCGG
CCCGGCGTATGGCTCAACGATATCATCATTCATGCTTTTCTGGAAACGCTTTCGCACAAGTACAAGAAAAACAAGACGATTTTCCTTCCACAGCTGAGCA
ACCCGGCACCAGAGAAAGGTAAACGCATTCCCCAAGCCACGCTCAACGCGCTCGAGACGACCTCTGAAGACTTCGTCTTCATGTCGATCAATTTGAACCG
ATGCCACTGGGCGTGCATCTTAGTAGACATGACGAAGGGAACACTCTTGTGCTACGACAGCGTGGACAGCCGTCCTCACCACAAGCTTCTGTCGGAGTTG
GCATCGGAGATGGTGGCAAGATCGCTGACCGGGTTCACGCACATCGCTGTGCACAACCCGTTGCAGAAGGATAGCAACAATTGCGGTCTCTTCGTGTGCC
TCTTTTTCTGGAAGCGACTGTGGAAAGAGGTAGGGAGTGACTACACAGAGGAAGGCCTTGCTCGCAGACGCTGGCAGATTCTGCATGCAGTTGTGAACTT
CGACAAGGAGAAGAAAGAAGATGCTAGCAAGTAGATCTAAGTCTAATCAATGAGCATTGCATTACGGAACATTTTCACTGTCAACTTCACTTTGCGTTTA
TGTATTGACCAGGTTTTGGACATGTATCGTAGTGTAAATTGGCCATGTTCGCGGAACATGCATTGCCCAGGGTTTGAGTAAGTTTTGTGCATGCAGATGT
TTTGACAGGCCAAGCAATCAACGTTAGTGTACGTGTCATACTGTCCCTCTTTAATAGTTTAGCTGGCTTCTTCGACATTTAAAGCTGGACAGATCGAATG
GACAGGCTTGACCGACAACACCCACACACTCTCACTCTCCATTATTTTTTGGCGTTCCGCCAACATGTATCGTCCATGTTTTAGACATGGCCATGAACAG
GTTTCTTAACCAGAATTTATTTCCATATGCCTTCTGCTTCCGTCATTTAAAAGAAATCTTCCGCTTCATTTGAAAACATGGACGTTACCTGACGATACCT
GCCCAATACATGATAAAGTAGGCCTACCCCTTATAGAAAACATGGGCAGCATCAACAGCCATATTTGTTTCTACGTGGAGGAGCTGCAGGAGACGCTTCG
ACAGCGCTTTGGCCAAAATCTGTAGAGTTACATCGCTACAAGTATATTGCGGTTGTTTGCTTTGAGCTAGGTTTGTCTAGGAAGATTATGGACCGGCGAG
CCCGCGAGACAGTACCTATGGAGATCGAGTGCTTCATGAACAAGATGAAGATCTGGTATAGCTACCCAGAGCAGCTCGTTTTTATTGACGAGGCGTCGAA
GAACGGGTTGGATGCAACGCGACGCTACGCATGGTCACAGAGAGGAGAACGAGCAATCGTACGCACACATTTTGCGAGAGGTATTGTGCTTTCTACTCAA
AATTCCATGCGCGATTGGTTGAATCAACCGCGCAGGCAATCGCGCAAGCCTGTCTAATTGCATTGTTCATGTGTTAAGAGAGATAATGTGTGCACCACAC
GGTCAAATCTTTGCGCACTCTTCTCGAGCACACTCCAGATTGCACCCCACCAACAGCCAGCGGAAGGCAGCAACATGGTTGTTGACGATGAAGAAACCGT
CAGTGCTGTTGCAGCAGCCACCACCACCAGCCAAGGAGACGAAGCGACAAGTTCGCGCGAATTACCGCCAACAAGCCGACGTCGCAGTGCCATGCACTCG
ACGCCACGGTCAACTCCGTCCCGGACGACTCGC