Description :
From Genome Similarity Track
Location :
Scaffold_66:6808- 9104
Transcript NameFunction/comments
Phypa_INRA-310PPTG_17329hypothetical protein

Sequence
2296 bases(100 bases per row)
GATTTAATCGAGCCATATACCGACTTGATCTGCCGGGCCTACGTACGCTGGCGTGATCGCAACACCACCTCGAGGGCATCTGCATCGGGAATCCTAAGAA
TTGCGAGGTGATCAGCTAGATCCCGGTCGTCCAGCGTCTCGATGAAGTGATCAACATGTTCACAGCAGACTTGCAACGGACCATCCTTGACTTGGATTCG
AGCGCGTAGATCCGCGACATTGAGGCGATACGATACTCCAGTGGCGACTCATCGGGTCGTTTCCGCGCATGTTAGTAATGCCTTGCGACGGAAACACTGT
GGCCGCAGTATTCCGTCTGAAAGCTGTGGGGCAAGTCCTTCCACGTGCTGCGGGTTGTTCGACTTAGCTGTCGATACCAATTTCGAGCTGGTCCGGGGTG
TCAGCGATGTCTGAACTGAAGGAGTTCTCTGGAAAGGACGGCGACAACGATCGAGCCGATCTTTGTTGAACAAGGTTAAATCAGCCTTTGTGCGAGATCA
AGCACCAGATGAGGAGAAGTGCCTTGTCTTTGGCGATCTCCTCGCGGATACGTGGGACAGTCGTGGTCTTCGTAGGCGTCTTGAAGGCGTCGTAGCGACG
GCAGCACGTCGATAACATCAAGATCATTGGGGTCATAGTCGTTTGGAAAGAGATGGTGATCTAGAGATCCAACCGACTCCATCTATACGTCTTGGGCTCC
AGTGGGTGTTGGATCTTCAGGCGCCATCGCTATCCGCTGTTCTTCAAGGAATCACCCCATCACCGACTGAAAGAATGACTCCAGCTTCTCCGGCGGAAAA
ACCGCGTTACGCTTGCGACAGCGAAGCCTCTCTCAGTGGGTGGACTTGCAGCCTTCTGGGCGGGTCGATCTCGTAGCAACGCGGTTCCGGATGGGCCTAG
AGTCATTCATGGCGAGTCATCGACACTGTCGGTGTTCACCTCCTCTGTTACAGACTGATAATGGGAAGACGACTCTTTGTGATCGTCCCTTGGGGAATCA
GGATGGGGTATTTTGCTCTTGGAGATCTTGTGGGCTCCACCCACCAGCGGCTTCAACATCTCGAACAGCGTCCTGGGCGCAGCACTGATGACTTCTTCGC
TAAGGTCGAGCAGATCATTGGACTCAAATGCTCCAGCAACAATTCCGGACTCCTTGAACAACCGTAGCCTTGCTTTTACGTTGTCCAACGTATTCAATCT
CAAGGCCAGTTCAGATACACAACCCTTCAGATCACCGAACAGCTTCGGACGGAGGATGTGCATCACAGCGTCCTCAGTTAGAAACGTGTGAAGCTGCTAC
TCGTGATACACGTTCTCGAGATGTTCATTCGCCCAAGCCGACATACGATCGATGCGATCGTCGATGTCCGAGTCTGGTGCTTTCGCTAGGACTTCGATCT
AGCTGGCTTCTTCTTGACGGTCGATCTTGAGCTAGAAGGTTGCTGAGACAAGACGTTCCCGGCTTTCGGTGGACTTTCGTCCAGCGGGTTCTGATGCGAA
TCACAACTCGCAGGGGTCCCCGAAGGGACCTGGGGAGGAGGTTGAGGTTTTTCTTCTAGGTCTGTCGCCAGACCTCCCTCTGTTCCGTCGGTAGAGCTCC
TCTTAAAACTCTGCCGATCTGTGGATCGTTCTTGGCTTAGCGAAGTCAACGGCGATCCAATATCCGCCGACGCTTCGTTCCCTAGTCCAATTCCAGCTTG
GACTTCTTCATCTGGGGATTCACGGTGATATACTAAGGCACCCAAAGATCCGGGCACGCGCACCACTGTGGCGAAGTGGTTCTGCGAAAATTGCTGATTG
CTGAGGTCCTCTTGCCGACTATACTCCGATCTTCCGTGAAGTTATAATGCTCACCTTGTGTACCCGTCGGTGGGCCGATTCGCTCTTTGGGTGATTTTAG
AAACGACGCTTGGGCTGGTTTCGTGGATTGTCTGAGTAGACAGCGGGACGTTTGACAGCAACGGGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNACGTCTGTAGCGCGTCGTCGGGTGGGCCAAAGTCAATCCCGTGCCCGGAATAGCGAAGACGAAGAACACTTGCTAAGGAAGA