Description :
From Genome Similarity Track
Location :
Scaffold_51:680701- 683406
Sequence
2705 bases(100 bases per row)
AACTCCCACCGGATCGAGGCGTACGGCACGAGATTGATCTCGTGCCCGGCACAAAGTATTGTGTCACGAGGCAATGGCCTCTCCCGCGCGAACAGTGCGA
GGTCATTGATGCCTTCTTCGCCGCGAAAGCAAAGGCAGGCATGGTGCGGGAATCGAAATCCCCGCACTCGACACCGACTTTCTGCGTTCGTAAGCCGAAC
GGAAAGTGGCGTCTGGTTCACGCTTATAACAAGCTGAACAACGCAACGGTGCCGGCCCAAACACCGATCCCACGAAAGGATGTGTTGTTGAACAACATGG
CCGGGAGCGTACTGTACAGTGCGCTGGATTTGGTAGACGGATACTACCAAATCCTGATGCGAGAGAGTAACATCCCGCTCACCGCGGTAAGCACCCCAAG
CGGCATGCTTTGGGAGTGGCTCGTCATGCTGCAGGGTTTGTCCAACGCCCCGGCGACGTTCAATCGCCTGGTGACGCAATTGTTCCGCCCTTTGCGTACC
TTCGTACAGACGTACTTCGACGACATTTTCGTCCATAGCCGTGCCGAGGGAGGCAAGACGGCCATGGAGGTGCATCTAGGACACCTCCGTCGAGTGTTGG
ACGTGATGCGAGCGAACAAGCTCTACGCCAACATCGACAAGTGCGTTTTCGCGTCACCAGAGATCAAAGTTCTCGGTTGCTTCGTAAGCAACGTGGGCGT
TCGGGCTGACCCAGCCAAGGTCAAGGCCATAGCAGCATGGCCAACGCCCCGATCCCAGAAGGATCTTCGAAAGTGGTTGGGCTTGGCCAACTACCTTCAC
AAGTACAGCGCTGGGTACGCGGGCTTCGCTAAGCCCTTGTCGAGCCTCCTTCAGAAGGACGTCGACTGGCACTGGGAGCAAGAGCACCAGGATGCTTTTG
ACAGCATCAAGGCCAGTCTCCAAGAGGCCCCTGTCCTGGCTCTGCCGGACGAGACGTAGCCGTTTAGCGTCGTCTGCGATGCCTCCGATTACGCCATCGG
ATGTGCATTGCTGCAGGCCGACACGGCTGGACAGGAACAAGTCATCTCGTTTCAGTCCAGGCAGCTCAAAGCCGCCGAGCGGAACTACCCTGTCCATGAC
AAGGAGCTCCTGGCAATGAAATATGCCCTTGTGAAGTTCCGTGTTCACCTTCTGGGCTCTAGGCCCTTTGTGATCTACACAGACCACGCGTCCTTGAGGA
CGGCGACTAACTCGCCTCACCTCTCCCAAAGGATGGCGGGGTGGCTGTCCTTCTTCGCGGAATACAACTTCCGCGTCGAATACAAGCCGGGCAAGCTCAA
CGTGCTTGCGGACGCACTCTCTCGGCGTCCCGACTATGAGCTGTCCCACATCACGCGGGCGACAACGGATCTATATGATCGGATACGCATGGCGTATCGG
GACGATGAGGCTGTCGCGCCTATTGTCAAGTTCCTTAAGGCCGGAACGAGCGCGAAGTCCGACTGGCTCTCGTCGCGACAGCGCTCACGGCTCCACCGAT
ATGAGTTGAAGGAGGGCCTCCTCTATTATCGGGTGGAGCCCACTGATCCTCCACGGGTGGTCGTACCCAACGACGAGGATCTGAAGTTCGACATCCTCGC
GGAGGCGCATGACGCGCCCTCTAGCGGCCACTTGGGCCGCGAGAAGACCTTTCTGTGGGTCTCTCAGTCCTTCTGGTGGACCCACATGTACAAGTGGGTC
GCCCGGTACGTCAAGACATGTGAAACATGTCAGCGGGTCAAACCCGCAGGGCACTCTTCGGCTCCGCTACAGAGCCTGCCCGTACCGGCTGATTGTTGGA
AGTCGATGAGCCTTGACTTCATCTTTGGGCTTCCCGCCGACGGACACGGTAACACCGGAATTTTGGTGTTCGTGTGTCGTCTGAGCAAGATGGTACATCT
TGCTCCAGTTCCCGTCACTGTTACGGGCGAACAAACCGCAAGGTTGTTCGTCGATGGCGTGTTCCGCTATCACGGTCTCCCAGAGACGATTGTCTCGGAT
CGAGACCCGCGGTTCACTGCTGCGTTTTGGAAAACGCTGTTCCCTTTACTGGGAGCTCGTCTGCAGATGTCCACTGCGGACCATCCGCAGACAGACGGCC
AAACAGAGCGCGTCAATCGAGTGCTCGAGGACACTCTGCGCAGTGTGTGCGCGGCAGCGCCACGTACGTGGTCGTCGCAGCTTCCAGTTGTTGAGTTTGC
GCTCAACAACGCGGTGCACGCGTTCACGGGGCTCACGCCGTTCTATTTGAACGGCTTCCGCCACCCCAGAGTGCCTCTCACTCTTCGAGGAGACACTGAC
TCCTCTATTTTAAATGGGGGAGAGGCTCGGAAAGCCCTTTCCTCCCAGGTCTCGGATGTGAGGCCAGTTTCGCTGCGGAAACAGGTGGAATCCTTTATGG
ATACCAAGCTGAGCATTGTCAGCAGGGTCCGCGATGCCATGGCAGCGGCCCAAGATAAACAAAAGAAGTACTCGGACAAGCAAGGAAGAGGAAACTTAAG
TATATTTGAGATTGGTGACTTAGTGTTGCTAGACACGAGGAACCTACCTCTAGACACTGTTAGCTCTGTCGGCAGCAACAAACTGAAGCACCGCTTCATC
GGACCTTTTGCAGTCCTGGCCAGACATGGTGCGTCGTACACCATCGACCTTCCAAAGTCAATGACGACGCACCCGACGTTCTATGTCGGACGTCTTAAGC
GGTAC