Description :
From Genome Similarity Track
Location :
Scaffold_12:6807- 8747
Sequence
1940 bases(100 bases per row)
ctgcggacgacacagcattgacgcgcgggacttcgatactcaagtcatcggggtcatactcgtctggatgatcgttgtgcgatccaaccgactccatgtc
gacgtcctgagtgccgacgttcttcggaagatcaggcacgcgcgacgtcatggcaacagcagctccttgctccttctggtagcgatccatcgcggcattg
aagaacgattgaagactaccagggctggacgcggcggtcgacaccggcacggtgtcactcttcctggcttccaacaaggctgctccggctggtccaagcg
tcatcctgcttagctcgatcgagctatcggatcccgcctccgatactctcgcagatgtcttcgcagacgcgaacgaggagtggggtgatccggactggct
cgagtatgtcgtcgtcagcccctggtcggcggtcgagatgacggcgccaaccaacggtgtgagcagcttcgccaagtgtttggtggatccttcaagggtg
ggaagatcaagctcgagcagttcctcggcgttgaagttcccggccacgatacccgcttccttcagcatgcgcatcagggcgctgatcgcagccgcttgat
ccactggcttggctggcttggtcaccgggccttgaagatcgccgatcaacttcggcttcatcatcttcatgactgggtcgtcgaccaagaacgcgcggag
tttcttccggtagaggacgacgcgcagctcgtcttccgtccaagtcttggtatcaccactctcgtccgcgtcgggtgccttcagcttcatcttcgcgggc
ttcggcgtcgccttcttcgacttcttcgaggaggagagcggagtgggggtggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnaggagagcttgtagttgtgtt
aaagcgtcctggggagtgttgaggcgacaatatcaacgtacgagcggcagatcggggtgctggtgcgttaacactggctgcttgggttggctgggaagtt
gttcgtgatcctgggcgctccgttagtcctcttagagattgtgctcctggtgttcgctgtggtgttcgctgtagtcgtggttgcagtactgcacttggag
tgacactttgccatgttggatacagagatggaggcgacga