Description :
From Genome Similarity Track
Location :
Scaffold_59:68065- 70993
Transcript NameFunction/comments
Phyci_116173Hypothetical protein

Sequence
2928 bases(100 bases per row)
ATGAACGCGGAGGCTTTGACGCGAGCGATAAAAAGCAGGCTGAAACCTTGCATTTCCACTTTATTACGACTGCATTTTAGTCTTCAACACGGTACACACA
CATACTCACACCTATCGGCGCTTTCTTTCGCGCCGCTCACTAACACCAAAAACTCGGTTTGGCACTTGGTCTACACGGGGGGCTTCTTCACATCATGTGC
ATGTTGGACCAGTTCTGCATGGTCGCGTCGCCGTTCTGAGCTTGGCTGGTGGAGACCACTTGCGATCCGGCGCCAGCGTTTGCCTCGGAAGCCGACATGT
TCTCCAACAGATCATCCCACGGAGCCGCCTGGCCCGTGCCGCTAGCGTGATAACCATCTCCGGCTCGTGGATAGGCTGCCGGTGTAAATCCACTCCTGTG
CTCGTGGACCGCTCCGTCGTGTGCGCCAATGCCCGGCAGCACTtgctgctgctgttgttgctgctgttgatgctgcACCACGTTCGCGTATCCCATGGGC
TTATCCGACCTGACGTCCGAATATGGCGACAGGCTTGACGGGCGCAGGAACGACTCGGCCTGATATTGCTGTGGATActgttgctgctggtgctgctgct
gctgctgctgctgGCTGTAATCGAATGCGGTGGCTGATGACGCCGGCGGGGAGAGGCGTCCATATTGTGGGTACTGAGATTGGTCCATCGGATGCAATCC
AAAGCGACTGACGTCCGCGCTCGCCTCGGGCGTGCGCATCTTCTTGACAGGACGCAATGACTGCTCCGGTTGCACTTGTTGCAATAGAGCTGGAATAGAC
GGTCCACTATCGTGCTGGTTTTGCCCCAGCACAGACGATGAAAACACAGCAGCACCAGCGCTCCACGACGCCGAGACAGCAGTGCTGGGCGGCATCGGGG
TCACGCTGGCCGTGTTAGCCGGCGACGGGTGGTGATTCCACGCCAGCAGCTCGTCGAACTGCCCGTTGCGGAGTAGCTGCATCGCGCGTTTGCGTTTTTT
GGCGTCGGAGACGTCGAGTCCCATCACCGGCTGGCCGACAAGCACTGCGAACTTCAGAAAGTTGCTCACCCAGAATTGCTGTACTGCCAGACGCAGGTTC
TGCGTCTCGACCAGCGCGCCTTCGTCCGTGTTGTTCTCGCGCCGGAACTGGTCCACGAGCTCCTGTCGGAAAATCTGCTCCAGTTGCGACAACTCGCGTT
GCCTGCGCGCGTGGTCCATCTGATCAAATTGCAGCGCCTTCTCCCCCTTAGCAGGCTTGGTCACCCGGAATGTACGCTTGCCCAGCGCATTCTTCTGGAA
CTTCTTGGAGAGTCTCATGGTCGAGCAGTTTAGCATCTTAGCTAGCACGAGACGGATCGGAGTACCGTGGGCCAGGGGCAACGCCTGGCGGTCGAACTCG
CAGAGAATGCCGTCGATGAACTTCTCTTCGGGTCGAGTCCACTTTCCGCTGCGGGGCTCGGGTCGGACCATCATGTTGACGGCCGGAGAGATGGCTACCT
GGTCCATGGGCGTGGCGCAGGCCGGACAGGCGTCCAGCGGCCACACGTGGACGCAGCGCGAGTGAAAGATGTGATTACAGTTAGGAGCTACGAGGACAGG
GTCGGGGTACTGACAGACATCACACATGCGTTCCATGGGCATGGGGGGCTCGGGGCGAGTCTCAGGGGTGGCCTGAATGCGGTAATCTGActgctgctgc
tgctgctgctgGTAGGCCGCGATGGGCTTGTGCTCGAGCGGGGACTCAGCGTACGGGAACTGAGAGATGGCCACGGGCGTGCGGCTCGGTTGGTAGTACG
TCTGCTGTTGCGGCGTGAACTGCGGGTGCAGCGGCGACGGGTGGTAGAAGGCAGGAGCCTCGAGCGTCGGCCGCATGCTCGGGATCGCGGGGCGCTCGGg
ctgctgctgctgctgctgctgctgGCTGTACTGGTCGCTGTATTCGTAGTCGTAGGTGGACTGCTGCTGGGGCCCACCACTTGGCTGCATTCTCGAATTC
TTGAAGACTGACTCAAAGACTGATGCTCGCGCTTCACAAATCATAAACCCTGCGCCGTGGACGGGCTGAGCTGTTGCTGTGCAGCGAAGGCTGGCAGTTG
GTAGGCCGGCGGTTGGAAGAATATGTAGGCCGCTGTCGAGACGGTCGTCCACCGAGTTGGCGGCGCGGGCTGAGTAAGCAGTAATGGATGAATTCGCGAC
TGAGACTCAAGTGGGCAAAGGGGGGAGGAGCTCGCTCAGGGGTGGCTGCTGCTGGCTCAATTCGGCAGTATCAGGCGATACAGTACAAGCCACGAGAAGG
TCCAGGATTAACTCCTCGTTTTTGTGGTCTTGCCTTCCTTTCCCCTTCTGGCGTTGGCGCTGGGCAGTGGAGTTTCCTTTGCTCGCGGGGTTAAAGGAGA
AGCCACACAATCGTGCCTGCTTTAGACGCGATTTGCTGATGCCGCCGATTGTGTTGTGTGTGAACATGTACGACGACGCTCGCGAAACGGGGTCCTGCTC
GCTTTGCTCGCTGCAGTTGCTGCTGTTGCCGCTGGCCGCGAGACCTGGCGCTGGCCCGTCCCACTCGATCGCGGCTGTTGCAAAGTGGCTGTCCTTGGAG
AAAGCGTGTGTGGGTCACGTTGCATTGAGTCGAGGCGCGTCGCGGTGGTGGGACCTCGCCACGGCGCGCGAGCATCGAGTCCCTTGGGGGACATGCAATG
CTGGACGAGCCGGAGCCGATGCATCCGCCGCCCGGTGCCGGTCACTGCGGCCGGGGCATCGGAAGCAGTTCATTCGCCTTGCTACCGTAGCCAGCTGACT
GCAACCTGCTGGGTAGCAGACGGTCGGACGGACGCCCCGATCCTCGGTCGGGTGGGACGGAAAGGACCGGCAGCGCCCGGAGCAAGCGCAGGATAGGACC
GCGGCGCCGGCCACCTGCTGGCAGGCAC