Description :
From Genome Similarity Track
Location :
contig_88:6806- 11900
Transcript NameFunction/comments
g13017.t1hypothetical protein
g13018.t1hypothetical protein

Sequence
5094 bases(100 bases per row)
TCACCAGACGTAGGTGACTCGTGCTGCACGTACGGCTTCAGTCGCCCAACGTAAAACGTTGGGTGCAAGCGCATGCTGGACGGTATGTCCAGTGTGTACG
CGTTGCCATGCTTCGCCAACACGGTGAATGGCCCAATGAAGCGCGGAGCAAGCTTGCTTGCTCCGAAATCGGAAACTGCATGTTTAGCTAGGTTCTGAGT
AGCTAACAGAACTAATGAACCAACTTTGAATTCATTTGTGTTTCCCCTGCCGATGTTATCGGCATTCAGCTTCTGTCGATCGACAGAAGCTGCTATTGCA
TCTTGGACAAACCGAATTACGGCTTGTCGACGCTGGACAAAGTCCATTGCATCCGAGCTGAACCCCTGGTTCAGTTCGTGCTCCTTGTTCGCAGCAGGCC
CGGCCTGCGCGTGATGTTCGTTGTCGTTTAAAGTGTCTACGCCCGTCGTAGACACTGTCTTGTCGTCGCCATGACTGCGCGCAGTACGTGCGCGAGTCGT
CACAGCTGATACATTGCTTGTATCAGCGTGCTTATCCGGTTGTTTTGAATTAACCGGATATCCTCCCCCACTTAAGGAAGGAGCTACCGCACCGAGTACG
CTCGGTACGCGTGGGTGCCTCATGGCATTCACGTAGAACGGTGTGTGTCCTGTCGAGACATGCACCGAGTTGTTGATGGCGAACTCCGCCATCGGCAAGC
AGTCGCTCCATTGATGGAACGAGTGCGCGTAGCTCTTCATGGTGTCAACCAGCACGCGGTTGACACGCTCTGTTTGTCCGTCGGTCTGCGGGTGATCCGC
AGTCGACATGGACAACTGCGTCCCAAGAAGTGTAAACACTTCTTGCCAGAATCGCGCTGTAAAGCGCGGATCCCGATCCGACACGATGTCGAGTGGCATA
CCATGGTGTCTAAACACCATGTCGACAAACAGACATGCCGTCTGTTTGGCTGTCACCTCGGCTGGTACTGCAGCAAGATGCACCATCTTGCTGAAGCGGT
CAACAAAGACCACAATACCAGTCCTCCGCTTGTTGTCTTGCGGAAGACCAAAAACAAAGTCCATTGAAATGGACTGCCAGCACTCCGACGGAGTCGGTAG
TGATTGAAGCGGAGCCTGCGAGTTGGGCGCAGGCTTCACGCGCTGGCATACCTCGCAAGCACGAACGTACTTGCGTACCCACTTGTACTGGTGACTCCAA
TAGAAGTCACGCGTGAGAAGCAAATATGTCTTCTCACGGCCAGGATGTCCCGATGTCGGGGCATCGTGGTACTCGTACGTGATCTTGAGCTTCAGCTCAT
GATCATCCGGCACGACAATGCGATCTGCGTTGTCGTCGACTGCGCTGTAAAGCAGCAGACCATTGTGTACACGATAACGGTGTACACGGGCACGAAGGTG
TTTGGCCAGCTTCTGACGAGACTTGTCAGAAGGTGTGGAGAAGTACTCCACAATTGCTTCGCATCCGCATCATGTGCGTATGCGGCCTTCACTTCGTCCA
GCAAGGACGACGAGGGTGTAGTCGTCCTGACGACGCCAACTGCGTTGGCGTCGGCCTCTTGCACCGCATAATCTGGTCGACGCGAAAGCGCGTCGGCCAC
GACATTCAACCTTCCAGGTTTGTACTCAACCTGGAAGTTGTATTCAGCAAAGAATGACAGCCACCGTGCCATTCTTTGTGATATGTGCGGCGACTTGATC
GCCGTACGCAACGATGCGTGGTCGGTGTAGACCACGAATGGTCTACTCCCAAGTAGATACACTCGAAACTTTGCGAGTGCATACTTCATGGCAAGGAGTT
CCTTGTCATGTACCGGGTAATTGCGCTCAGCTGGCTTCAGCTGACGCGATTGGTAGTAAACCACACGATCACGACCTTCGTGATCGAGTTGCATCAGTGC
GCATCCGATCGCGAAATCGGATGCATCGCACACAACGTGGAATGGGCGATCTTGGTCGGCCACCGCCAAGATCGGCGCCTCAGTCAAGCCCTGCTTGACT
GCTTCGAAGGCCTGCTGACAATCAGCAGTCCATTCCCATGCAGCCTCTTTCTTTAAGAGCTGCGACAGCGGGCGAATCTTGCCCGCGTAGTTGCTCACGT
ACTTGCACAAGTACGTGGCGAGTCCAAGGAACTGCCGCAGTTCCTTTACGTTTGAAGGCGTAGGCCATTCATTGATCACTCTGACCTTTCCTGGGTCAGG
GCGTACGCCGTTCTTCCCCACGAGACACCCAAGTACGGGTATCTCGGTCGCCCCGAAGATACACTTCTTCAGGTTCGCGTAGAGCTTGTGCTTTCGCATG
AGCTCAAGCAACTTGCGGAGATGCTCTGTATGCATCTCCACATCCGATTTCCCATTCACAGCCCGGCTGTGAATGAACACGTCGTCGAAATAGCTCGGTG
CGAAGTCGCGCACCGAGCGCAACAAGTGCGTGACGCACCTGTTGAACGTCGCTGGGGCGTTCTTCAGCCCCTGCGGCATCACGAGCCACTCCCAGAGCAT
GCCGCTCGGAGTGCTTACCGCCGTGAGAGGGATATCACTCTCACGCATGAGGATCTGATAGAACCCGTCTCTCAGATCCAGAGTACTGAAGATAGTACTC
GAGGTCATCGAATCGATGATCACATCTTTTCGAGGTATCGGCGTCTGCGCCGGTACCGTCGCATCGTTCAGCTTGTTGTACGCATGAACGATGCGCCACC
CGCCCTGTGGTTTCTTCACACAGAACGTAGGCGCGCTGTGCGGGGACTTCGATTCCCGCACTTGTCCTGCATTGCGACGACTTTCAAAGAAGTCGTCGAT
TGCCTTGACTTGCTCACGCGGCAGTGGCCACTGTCGCGTGACGCAGTACTTCGTTCCCGGCACGAGATCAATCTCGTGCTGAACACCCTTGTCCTGCGGT
AACTCCGCAGGAATGTCGTCCGGGAGTACATCCTTGTACTCACGCAAGACCTTGTAAAAGGGGCTCGCCTTGAGCGAGTCCCAGCCTTGCTCGTCGAAGC
GTTCCTTCTTCGACTTCGCGCTGAGGGCGTCCGCGCCCTCAGAGATGAGCTGATTCAGCTCTTCTGCTTCACACGTCATCCTCTCGACGTCCGAGAGGAT
GCAGATCTGCTCGATGCGTCCATCGTGCAGTTCGCGAGCGAAACGCTTCCAGCTTGTGACTGGGAGCGACATCAACTCCGACGCTAACGTCGGAGGATTA
TTCAGCCTCATCTTCTTGTATTGGAGACCAATACTCGTACGCGTCAAGACATTCAATGTCTCGACGGTCGTCTCCAACTCCTGTGTCTGCCCGGCAGACA
CTGCTTGTAGCGTCTCGGTCCCTGACCGAGACTTGCGCAGCTTTTCTCGCTTGCGCCGTTCACTTCTCGTGCGGAGCCCGGCTCCGCGAGTTTCTTCTTG
TCCAGGCCCGGCCGTGGACAGTTGTTCCTTGTATTCGCCGGCGGGTTTTACCCGCGGGCGCACGCGTTCAAGCCCGGCTTGATCGCGCACCGCTTCGTCG
TGCAGCCCGGCTGCACGCGAGCTCGCAAGCATTTCCGGTGCGGGACGTTTGCAACCGTCCGCACTGCTTGCAGCGTCGGCTCCCAGAGCCGACGCGTCTT
CTTTACCTCTACGCCTAACGGCGGAGTGTCTTTCGACCAATTGTGTGTCGACATTACTGTCGACACTACCGCGTCGCCCCGGACGCTTCGAGACCCTCTC
GAATCGGATTGAACCAGGCCCTGCTGATTCGGTTCACATCTTCTTCCAACGACTCTCGCAGTCGTTGGCGTTCGCTTGGGGTGACCGGAGACAGCCGCAT
TCCGCGCTGTCTCTGTGGAGGGCCGCATGCACCACGTGGTGCATGTGCTGCGCCGACAGGGCCATCGCTCTCTGTCGCGCTGCTGCTGCTCCCGAAGCGC
ACGATCGTGCGCTTCGTCCAGTCGATCACCGGATCATGCCGTGCAAGCCACGGCATGCCCAACACCATATCGAACTTATCGTCCAGTTCCAGGACGATAA
GCTCGTCGACGAACTCCTTCTCTTGATAAGAGAAGCGTACGCGTACGATACGCTTCTCGGTTCTAACAACGACACCCGTTGCTAGCCTCACTTCCAATAG
ACTTCGAGGTGTTTCCACCTCCTCGAAGTCAAGCCTTGGAAGGCTCTGCAGTCGAACAAAGTTGTTCGACGCTCCACAGTCCACTAGAGCACGAAGAGAC
TTCTCTCTCTTCGAGCTTACCTTCAGGATGACAAGGTTCGGCTTGTCATCTTGCTTCTTGCAGTGAGATTGACTCTCACTGGGGGCAGCGATCTTCATTG
CAGCGTGTCCGATGTCGACACGCTCGATCGCATCACCAGCAGGGCGCCCCGCGCCTGCTGGTCCCTTTAGTTTTTTGATTGCCCGTGACGATACCCAGTA
TCGCCACGACGGCTCCTCGCCGCGTGCACAGGTGCTGTGCACTCGCGGGCGTAGTGACCGATGTTTCCGCAGCGGAAACAACGCACATTCGTTGATCCAC
GACGCTGCTGGGAACCAGCAGCGGTCGCACTCGAGAGGTCCATTGGTTCGGGACCTCCCGACGGCCTTGCCACCGGTCGTGGCATCAGCCGTGGGGCGTT
CACATGCAGTTTAGCCTGCCGCAGGCTAAACTCTTCTTGCATTGCAAGCGCAATTGCAGCCTCGAGAGTATTTGGATACTCTCGGAAGAGATAGGTCTTC
ACAGGCCCATCTCTAAGGCCCTTCATGAACGTGACGACCTTTGTCGCCTCGTCAATCGGGTTGGTCACGATGTTCGAGACCAAGTACCGTGCTCTTTGGG
CGTAAGCATGCACGTCATGCTTGCCCTGTTGCAGATCGAGGAACTCCGCCCTCGATCGGAACTCGTTTGCGGGGGCTCAAACGCTAGTTTGAGCTCCTCC
TTGAACTCTTCGTACGTGCTAAAGCACGTAGGATCTGTGAGTCGGCGTCCGTACGCCCAACTCCTCGCTCGTCCGCCAAGACATGACATGGCGAACGCAA
CCTTCGACAACGGGTCGACGATACGTCGAGCCGTAATGGCAGTGTCGACCTCGACAAGCCAACGGAGGAGAGGTTCGCCCTCTCTTCCAACGTA