Description :
From Genome Similarity Track
Location :
scaffold_275:6806- 8989
Transcript NameFunction/comments
g6662.t1hypothetical protein

Sequence
2183 bases(100 bases per row)
GAAGATGAACTTCTGGTCGTGAGTTTCGACGGATCTGCCATTGTCAAACGTGGCGGAGGTACCTGTAGCGCGATCGTGCGGAAGCTAGGTTGGGAGGTGA
TGAAGGGCCGATCCGACAACGCCGAAGGTCTAACTGTCAATGAAGCGGAGTACAACGGACTACTATTGGGGTTCAAACTGCTGAAAGATCTGGGTCTAGA
GCGTCTCCTGCTCTGCAGCAATTCTATCCGCAATCCGGCAAGTGCGAGGAGAGATCGACTGCCGAGCACCGGTTCTGACCATACTGAAGCAGAAGGCCCT
GAATCGGCTGCGAACTTGGCCAGATCACGATCTGGCTCATGTGAAGCGGGATTGGAACGGCAGTGACAGCGCTCCAACGACAAGGAGACGTAGATGTAAC
CGGCGAATCGGATCTTCAGGACTTAGTTACTCCGAATCGGTTGGACGAGATCTTGATACCAAGATCCGAGGATCCCGTGTCCGGATCTCGGCGGTGACGA
CTAGATCCGATGCCACACGCAGATCCGATCCGACGGTCCTGCATGAAGCGATCGTCCGAGGGATGCGCATTGACAGGATCCGCAAGGCACAGGATGAATA
GGTGTGGATCACAGGCATGACGAATTATCTGATTGGGAACGTTGTGGATCTAAGCCAGGAAGAGTCGAGATAGTACGCCAAGATCTCGGCCGACTATGAG
ATCGACGATCTGGATCTGCTGTTCTACTGTCCACCTGGCAAGCGATCCGAAGCGGATCGTGACCGACTGATGAAGCTGGTAGTGCCGGAAGCTTTGCAAC
AATACTTCCTTCATCACTATCACTCGAGTCTAGTAGGCGGGCACTAAGGGATCGGGCGCACCTACGATCGGATCCGGAGCCACTTCCACTGGAGAGGCCT
ATTCCGGAGCGTACAGAAGGATGTTGACGAGTCGGTGGACTGCGAGACTGGAAAGGGGAGGCCTACGATCTACGGGGAATCGCCGGGGAACGTCCAGGCG
ACAAATCCGTCCGGCTCATCGATATCCCGTCGCTGCCCAAATCATACAAAGGGAACACCGAGCTGTTGATCTGGGTGGGTCTCTTCACGGGTTTCGTGAT
CGCGAAGGCTAGTTCGTCCAGGACTCCACAGACCATCGCTGAATAGTGTGTTCCAACGATTTGGGGCTAGTGAGGTGATCCATCACGATCGTGAACCCGG
CTTTATGTCGGGTTTCTTTCGCGCCATCAACAAGATCGCCAGTCAGCGACAGGCTATTGCATACCGGTCGCAGGCAAATGATACGACTGAGCGCGTGGTA
CAGACGTCCATCTGGACCAACGTGACTGGAATGAATATGCAGAACCTGTGCGATTAACACCGCCCCCGATCGGATCAGAGACGATACGGCCTTCTATGGC
TGGGATCCGAGATCTACACTGGAGGCGACGATCCCGATCGGGAGTACCCGACGCCAAGATTGAGATCCTCGGCAGTGGCGCATTCAGATCCAGCGACACT
ACCAGCACGCTCGTGAGCAGGTCAACAATCGGTTGCGAGATGCGATCTCAGATCGAGCGGCCCAGCACAACGAAAACATACGTCCTCATCAGATCGAAGT
TGGATCCCGAGTCTGGCTCTACCTAGATCGGGTGAAGGACGGAAGCTGGTCCATCTCTGGCATGACCCGTTCCGGGTGATCGAGAAGATCGGCGAGTTTG
CGGTGAAGCTAGAGACGACCGGGACCAGGTACCATCTATTCCCTGTGGTGCATGTATCCCAGCTCAAACTGGTGAAGGAATTCCCAGATTGTCCCCATAT
CTGATTGGCCGCGGCAGGCGAGGATCGGATCGACTTTGACGAAGAACTTCTCCCGGAAGATAGCTGAATCCGCGATCTAGATCTGGATCAGTACGAGGTG
GAGAGGGTCTCCAACATGCAGACCGGCAGCAGGACCAGGTATGAACGGACGTTCCGGGAGTTTCTCATACATTGGAAGGGCCGACGTGGATCGATGACGC
GGATCTCAACTGCGGAGCGATCCTGTTCGAGTTTCTGCGAGATCGTACAGATTGCAACCGGGTCAGTCGCACGAGGAGTAGTGAGGCCGGGATATGTCAT
AACGGACGAGCAGATGTAACAGAATGCGGTGAAGAAGTCTGCAGGGTGGCGGCAGATCGGACGAAGAAGATTGTGTTTGATGT