Description :
From Genome Similarity Track
Location :
scaffold_989:6803- 8708
Transcript NameFunction/comments
g10779.t1 hypothetical protein PHYSODRAFT_472299

Sequence
1905 bases(100 bases per row)
TCCTGGTTCGCATCGGTCCTGGCTCAAGCCCCCAAGGCTCCTTCGGCCGCGGTGGCGGCGGGATCTCCGTCGTGGCGCTCGCGGCGAGGTTCTGCCACTC
GTTGTAGTGCCGGGATCCGACGGAGATGAAGCCCGGAGCGTGAGGGACGTGATCCCCAGCCAGCCACATGCCGATCTCCTCGTTGTGGTTCAAGGAGATC
GCCGCCTCACCGATGTTGGTAAGTTGTAGGTAGCAGATCTTGTCTGGGCCTTGCGCTAACGTCGGTACCCAATGCTTTCCCCTTCGTAGCCACAGCTTCT
CGTAGCCCCTGAGGCGGATCCGATCCGGGTGCTCGAAGGTCTCGCCAGGCTCCAGCCGTACGCCTTCCTGGAGGAGCAGGGGCCGGGCTCGGCCGCTGAA
GATCTGGCGCCGCCCGTGGAGCCGGATCCGGATCTCGTCGTGCAAGCACACGGATCCGTCGCCCAAGTCGAGCCGGATCTCGGCCGGGACCATGAAGTCC
ATGCCGAGGATCGCGTCGCAGTCGGGTGGAAAATCTTCACCGACCCAGACGTCGCAGAAGTACGCCAAGTACCCAGCCAAGGTAACCTTGATCCTTGTTT
TGCCTGCTGCAATATACAGCTGCTCACCAATTCCGAGGCATTCTTGTGTTTGACTGGTGTCAATGTGAGATCCAATCTTACGAGCAAAGGCGGCGTCGAT
GATCGACACCTCGGATCCCGAGTCAAGAAGCACGGTGGACTTGGCATTGTTGATCTTGCACGTTGCCTTGACCTGCTTGAAGTGCTTGCTGGGTACATGG
TACTTCCAGTACCCGCGCGACTCTCCGGGCATGAGATCCAAGGTCATGGCGATATCCGATCTCTGGTACTCGTCGTCTGCAGCGCGGAAGCTTGCAACTC
TAGCCGTAAGTTTTCCATGAAGTTCACGTGTACTATCCAATATATCCGCTGGCTTGTCGCTAACTGAATCCTTGGATCCCTTGTTCACATATGCATAGAT
GTAGGACGAGGATCGCTCGTCTCGTACCGGATCCAAACCCGGCGAGCGTCCTAGTTTAACATCTTCTCGGCTGCTTCGGGAAGCATGTGTTTGCTTGGAT
CAAACCACTGCCGGATCAAGTTGTAAAACTCCGCCATCTGGCACTTCCCATGGTCATGAAGCTCACCGCAGCCGCGACACACGAAGAAGCAGCGATCCGA
CGGGTGACCCTTCTTGCCGCACTTCTGGCAGACCAAGCGTTTTCAGCAACCGAGATCCGAGTGCTTCCGGGATCCGCAGTGCGAGCAGCGCTGTCCGTCG
TTCGAGAAGCGGGATCTGCGATTCGGTGGTACTGGATCCGAGTTGGTTTGGGTCGGATCCGAGGATCCCGCTCGAGGATCCGAAGATCCGGCCACACGGG
GGTCTGAAGATCCGGCTACATCCTGAGTGGAGCTGGCTTGGGGCCGATCACTTGACGCTGCAACGTATGCCCGGCGCAGCTCATCCTCGGATCCGGACTC
GTCCGAGTCGGATCCGTACTCAGACACGGCTTGCATGGATCGGATCGCCCGCGTAGGGCCAGTTGGCTGCGGGGCTGTCGCTGCCTTGGGGCGGAACTTG
CTGGATCCTGACGATGGCTTCTTCTGTCGGGATCTCGCGAGATCCCGGGCCCGCAGTACATCTTCGAGCTGATCCGCGCCCACATGTCGAAGCATGGTCA
GCTGATCCGCCAGATCCGGATCCCCAAGCGTCTCGACGAAGTGTTCCACGTGCTCGCAACGAGCCTTGGCGTCTCCGTCCTTGATCTTTACTCGGGCGCG
TAGACCCGCCACGTTGAGGCGGTACAGGTACTCGAGCGGCGACTCGTCGGATCTCTTGCGGGGGGGGGGGTATTGCCCCGCTACCGCGGCTCCAAGGCCC
CAATA