Description :
From Genome Similarity Track
Location :
Scaffold_1154:6803- 8255
Transcript NameFunction/comments
Pytul_var.sporangiiferumfgenesh_masked-pug3_contig_1154-abinit-gene-0.13Transmembrane protein 5

Sequence
1452 bases(100 bases per row)
TACGATCCTGCTGTACGCTCGCACGGGGGCGCTCGTGGAGCAGCAGTACGAGTGGTACTCGCTGAAAGCCACGGGCGAGCGGTTGTACAAGGAAAACACT
CCATTGCCAAATGCGATCCTATCGACGTGCCGATTCCGCAACGTGACCAAGGCGCCGCGCGGGATGCTGACATTAGATGCAGCAATCGCAGAAACAACCC
ACAAGCCACGAACCGTTGTGTATGTGGTGCCATACAACACGGAAGGACTCATGGAGCTCTCAGAGAGCCAAGTGCAGTTTACAAGAGAGGAGTCGTCCAG
CAGCAGCAGCAACTTGCGCGGCACAACAGGCAACCAATCCGCCATCATTGCGTACGAGAAGGCGAGACCCGTGGACGGTCTCACGATGTTTCCGTACTTC
TGGCACAGCATCCTTGGCACGCACTTTGATGGCAACATCACCTCGTCTCCGTGGTCGCGCACGATTGATGCGTTGAACTTGGAATACCGCATCGTGCGCA
CTCAAGACCAACTGGCGTCCTTGCCCAGTGGCAGCAACGTGTTCGCTATCGTGCAATGGATGCCAAGCGTCCTGCAGCTGCTCGGTTCCGGCGTGCTACC
GAAAGACGCAAACGTCGGGTTCACGGCGCTTTCACGAGAAGACTGCAACAATGTCGATGCGCACAAGTACATCAAGCACAAGCAGCTCAAGTTTGGGCTG
CTGCCCTACGGTGACTGCTCTTTGATCGATGGCGAACGGTTCTCCGTGATCCCGCTCGGTCCGAGCTTCGAGCACGGGTTCCCCATCAACGCCCACGAAA
CGGTGATCCCATCGGTTGCAAACCGAAAGTATCTGCTGAATCTCATGGTGAGCTGGACGGTCGAGAAGCCGACGCGGATCCAGGCTATGATATCTGCTTT
GCAAGTCTGCAACGGTGACGCCAGCCACCACAGATGCATCATCGAACACAACGACTTGATGTTCAAGGCGCTGCAGCAAGTGGACGCGCGCGTGGGCACG
AACCTCCGGTGGATGCTGTCGTCAGCACCAAACGCGTATATCGAGACCTTGAAGCAGTCGATGTTTACATTGTGTCCCCATGGCAAGAACCCCGAGCAGT
ACCGGATCTGGGAAGCGCTCGCAGCCGGATCCATCCCGATCATTGAGGAGTTCCCACAGCAGTCGCTTCCAGGCACGTTTTACCATCCGTCGTACCCGAC
AACATGGAAATGCGTCCCAGAAGACATCCACGGAGTGCTCAAGCAGCTGGATGCACCCGTGCTGTTCGTCCGGGACTGGCAGCGCGACTTGCCGCGCATC
ATCGCGTCTTATGTGTCACGAGAGAACGGGATAAACGAATTGATGGCGCTCCAGCAACGTGCAAAGCAGTGGTACCTGCGCCTAGGAAACCACTTACAGG
CCGATTTCATCCAGAAATCGCTGCTGCACTTCAAAGCAGCGTAGACGGTAAA