Description :
From Genome Similarity Track
Location :
Scaffold_733:6801- 15833
Sequence
9032 bases(100 bases per row)
ACAGCGCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NAGGACGTACAGATCCTCATCCACCTGTACCGTCGGGATTGGGATCTGGATCTGGCGTTTGGGCTCTTTCTTAGGAGTGATCCTAGTCAGCGCCTCATCC
ATCTTAGCTCGAGGAGTGATGCTCGCGGCCAAGACTCCCAGGATCTCGTCTTCTTCTTTCAAACATTTCACAATCTCCAGTGTCCAAGGCGAAAGTAAAG
CTGCCCACTGTCCCAAACGTCCTTGTAACCCGGCCGACTTGAACAGCCAAGCTAGCGTAGAGTGTCGAGTCAGGATCCGGATGGATCTTCCCACTAGCAG
GTTGTAATTCAGATCCAACACGCGCAGGAGCGCGAGTATCTCTTTCTCCACCGCTCCGTAGTTCAGTTCATTCGGCTTCAGTGTCCGGCTGACGAAGATG
ACTGGATGACAGATCCCCTCATGTGCTTGTACCAGAGCTGCTGAGATTGCCCAGTCACTGGCATAAACTATCACCGTAGGTTGACGTTCCGGATCGAAAT
GACGGAGGATAGGCGTGGTCGCGATCCTGTTCCTCAGTTCCACGAATGCGTGTTGAGCTCGGATCCACCGAGATTCTGCCTTTTCCATGGTTCGATCCGT
CGTCTCTATCCAGACTGGATCCTCTTTCCGTTGGTCCCGGGGTGGATCCAGCTCCTGTTTTAGGTCCTCTTCTGACGTCGTACCACTTGGATCCCTTCGT
GGATCCGACATTTCCCGGGCCAGAGCTTGTTGGATTTTGATCCGGACAGCTGGAGTGGTCATCGCAGCAAAATCTACCTCTCTCAATTCATACAATACCG
CGGCAAACAGGGCGTAATCCTCGATGAACCGACTGTAGTAGTTCAAACTGCCCAAGAAGGATTGTATCGCCCGTAACGACTGTGGGAAGGACAAATCGGC
TAATGAAGACAGGTCCTTAGGATTCGCCTCCAATCCCTCCTTGGAAACTCGATGGCCTAAGTAATCCACCTTGCGCATCCCCCAATAGCTCTTTACCACA
CTGATAAAGAGATTCCACTTAGTACACGCCTCCAGTAGGGATGTCACTCTCTCGCACAACTGATCCCACGATTCCGCCGGGATCAGAATGTCGTCGATGT
AAGATCTGCGTCCTAACACAGACGGGGTCCCAGAATCCCCTGGCTCCCCCGCTTCGAATGGATCCACTTCCGTATGGCCTTCCCCGGATCCACCCGTTTC
GGGCTCCGGTATTCTGGTGAACCCATAGAGGGCGTTATCGATCAGGCGCTGGTAGATCTGGGGTGCGTTCTTCAATCCAAACGGCATCCGGGCCCACTCG
AACAGGCTAAACGGTGTGATGAATGCGGATATTGCGCGAGCTCGATCCGTCATAGTAACCACCCAGAAACCACTGGCCATGTCTAGAGAACCGTACCAGA
GTACTTTATCCAGATCTTCCAACAGCGCATTGATTAGAGGCATCGGATACACCATCAATCGAGTCAGACCGTTAACCAGCCGGTAATCCATGCACAGACG
TATATCCACACCGTTCTTCTTGATGATGATTACCACCGGAGATGCCCACGGGGACGTTGAGAAGCTGATGATCTTGGTTTGCAGCAGGCCTTAATCAGAT
CCGACAGTTTCGCTCGGAACTGACGTGCCACCTTCCGCACCCTTTGAGCGATCGGTTTCGCGTCGCCGACATCGATGTCACATTTGACTCCGCGGGCAGC
GGGCGGTAACGCATTACCTTTACCGATCAGCAGATGTCGGCTTTCCCAGATCTTCTGACGTAGACGATCCACTTCAGTGGGTTCGTTCGCCCCTGGATCC
ACTTGGATATCATCAATCGTGACCTCCTCTGTGGTCAGTGGTACCTCCGGGATCACCGCCATGCCTTCTCCAAGATCTTCGGCGTGTAGATATCCGCCTT
CACGGTAGCAGACTTGTTCATCTTCAGTCTTTGTCAGATCCACCCTTTGATCCAGGCACCGCGACTCCCCTTCGACCGTCATCCCTTCTGTCTTCGTGGG
GTCGGGTATCCTGGTACTGGGGAAGCCACCTTTTGGATCGACTTGATCCTCTGGTGGGTTTACCCACGATGGTTCCTGCTTAGCTAGTGCGGCCACTCTC
GACAAGGATCCAGACACTTTGCCCCATGCAAAGTTAGGATCCACTCTGGGGTCAGCGGGATCTGGCGGTCCGGCTTCAGCCCTCTGCGATCCTTCATCCA
CCGACCCTGCGTTATCTAGGGGCCGACTCTGGGGATCATCCCCCGTCGTGGATCCAACCTCCACTGTTTGGATCTCAATCCGACGATCCCTCTGCAGGAT
CTTTCGCGGAGTTGGATATGAAGGCCGATCCACCAAGGGGGCAGTTGGCCCCGCCGGGAGCTCCACCTCTCCGAAAGACTCGATCTCGGTAGTCGCCTCG
TACGCCAGATTCTGCCATTCTTTGTAGCGGCGGGATCCCACTGACACATATCCAGGTCGTCTAGGGATACCGTCCTTCGCCAACCATCGCCCGATCTCCT
CATAATGGTCCAGTATTAGTCTCCTGTCGCTGACTTTCGTGACCTGGAGGTATTGTGATCGACCTCGTCCCCGGATTACGGTAGGCACCCATTTCTCGCC
CCGGGTGACCCACCGTTTCTCATGTTCCACTCACTTCAACCGGTCTGGCAGCTCCCAAGTTTCCCCGGGCTCGATCCAGGTGGTCTTATCCGCCCTTATG
ATCCTCATCTTCGCTCCATACAACGGCCGCCGTCCGCTGAGCTGGATCCGCATCTCGTCAGGGAAACAAAGTGTCCCATCCGCCAGATCCAGCCTCACTC
CGGCTGGTACCATGAATTCCATCCCGAGGATGGCGTCTTGACCAGCGAGATCTCCAACCCAAATATCAAACCAATACACCAAACAACCTGCCAGCGTGAT
CTTGATTCGCGTTCTCCCGTTCGTGCGGTACACGCCTTCACCAATCCCAACACAATCTTGGATCCGACTCCCACCCACTTGGCACCCAACCTTACGAGCA
AAGACGGTATCTAGTATAGACACCTCGGCACCACTATCTAGGAGTAGGATTGCTTTTTCATTGTTGATCTTGCCCCCTACCTTGGCTTGTCTGAGCCACT
TTCCTGGGGCATGGTACTTCCAGTATCCACGGGACTCCCCGGTTAGCAGATCCATGGATCCAACATCCTCAGATCCACGGGATCCAGTGACCTGACAGAC
CTTAGGTGGATCAGCAGTGACCTCACCCTTGGTAGGCTCAAACCATCGACCATGTTGGCGCTTCTCCCAATAACCACGTGCCTCTCCTCTTGGTAGATCA
AGGGTTGAAGAGACTTCGGATCTGGCAAACTCATCCACTTGGCGCAAGCTAGAGATCTTGGCAACTGACACTTCATGTAGATCACGTGTATTATCGACTG
GATCTAGGGTCCTGCTACCTGGATCTAGCGATGTCTTGTTCACAAATGCATAATTGCAGTACCTAGAACGCTCGGCTCGTACCGGATTCAAACCCGGCGA
GCGTCCTAGTTTAACATCTTCTCGGCCACTTCTGGCAACATCCCTCTGTGCTTCGCTGGATCAAATCACTGGCGGATCTGGTTGTAGAATTCCTCCATCG
GACACTTGCCGACGTCGTGAATCTCGCCACAG