Description :
From Genome Similarity Track
Location :
Scaffold_690:6801- 8563
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_690-snap-gene-0.8CTP synthase

Sequence
1762 bases(100 bases per row)
TCTCTCTCACACACATATCTCTCCAAAGATGAAGTACCTCGCAGTCACGGGCGGCACCGTCAGCGGGCTCGGCAAGGGCATCACCATCAGCAGCATCGGC
GTTGTGCTCAAGGCGTGCGGCCTGCGCGTCACGTCCATCAAGATCGACCCGTACCTGAACTGCGACGCCGGCACGATGTCCCCTTTCGAGCACGGTGAGG
TGTTCGTGCTCAACGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCGGCATCACGCTC
ACGCGCGACCACAACATCACGACCGGCAAAGTGTACCAAGAGGTGCTCCAGAAGGAGCGTCGCGGTGACTACTTGGGCAAGACCGTGCAGGTAGTCCCGC
ACGNNNNNNNNNNCCAGGACTGGATTGAGCGCGTTGCGCAAATTGGTGTCGATGGTCAGAATGTCGGCGCGTCCAATGAAGCCGCCGATGTGTGCCTCAT
TGAAGTTGGCGGTACCGTTGGCGATATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNTGCACGTGTCGCTTGTGCCAGTGCTCGGATCGGTCGGCGAACAAAAGACCAAACCAACGCAGCACGCCATCAAGGAATTGCGC
AGCGCCGGTCTCTCTCCGGATGTCATCATCTGCCGTGCCAGCACTGAATTGGAGCCATCGACGCGCGCGAAGATCGGCATGTTCTGTCAAGTGTCGGCCA
ACCACGTGCTCTCTGTGCACGATGTCAGTAACATCTATCACGTGCCATTGCTCTTGGCCAAGCAAGGTGCTGCGAGCATCTTGCTGTCGAAGCTGCAGTT
GATGAATCGTTTCCGTGAACCAGATCTCGTTGAGTGGGCTGCGATGGCTCACCGCGTGGACANNNNNNNNNNNNNNNNNNNNNNNNNNACCGAGACGTGC
AAGATCGCTCTTGTCGGCAAGTACACGGGTCTTCAGGACTCGTATTTGAGTGTGATCAAGTCGCTCAAGCACGCGACCATGAAGTGCGACCGTGACTTGG
AGATCGAATGGATTGAAGCTGGCGACCTCGAGCTTGAAACGAAGCAGAGCGACCCAGAAAAGTACGATGAAGCCTGGAGAAAGCTGAAGAGCGTCGATGG
TATCGTCGTCCCAGGTGGCTTTGGTGACCGCGGTGTTGATGGCAAGGTGCTGACTGCGCAGTACGCGAGAGAAAACAAGATTCCATACCTCGGTATCTGT
CTTGGTATGCAAGTGGCTGTGATTGAGTACGCCCGCAATGTCTTGGGCTGGAAGGACGCCAACAGTGAAGAGTTTGACGCGTCTGCTGAACACAAGGTGG
TTATTTTCATGCCAGAGATCAACCCTGAAGTGATGGGAGGTACGATGCGTTGCGGTGAACGTCGCACTGTTGTCCACGAACAAGACGACCCAGCGAAGCG
CTCGTTGGTCTCGTACTTGTACGGCAAGAACACGCGCATTATGGAACGCCACCGTCACCGCTACGAAGTGAACCCTGAATTTGTGTCGACGATCCGTGAA
GCTGGTCTCAACTTTGTTGGTACCGACGACAAGGGCGTGCGCATGCAAGTCGTCGAGTTGGACCGTGACGTGCACCCGTTCTACTTCGCTGCGCAGTACC
ACCCAGAGTTCAAGTCGCACCCGAACGACCCGTCGCCACCCTTCCACGGACTGATCCTGGCT