Description :
From Genome Similarity Track
Location :
scaffold_891:680- 3719
Sequence
3039 bases(100 bases per row)
CATTTGCGGCATTCATCGTTAATTGCAAAATGGATTCTTATTCTTTTTTGCAGAAAGAGTAGTGGTCGTTGCTAATCAATCAGAAGTCTAACGTATAAAG
TCCATATCTAACCATGTGCCTGTGAACTATTGAAATCTACGTACTACGTTGTTCTTTTAATCTTAAAAAAGTGGCGTATATTCGTTTTTTTATTTTCTAA
ACTAAAATTCTGCGTATTACATGGCGGAACTGACATGCGAAATAAATGTTTGCTGGATAAAAGCTCTAGATGTTTCTGAACGTTTGCCGTGGATTTCATT
GCCTGTGTGGCAAGAAAGTTTTGCAGTGAGTCCCTTTCGGGTTGCAATTTACATGTATTTGCCTAACAATATAGTCCGCTAGAATGAAAGCTGCTCCTGC
TGCATCAAACCTTGTATGCAGTGTTCTAAGTAGCGTATGTGTCTACCCAAACAAGTGTTTAATTAAGGACTTCAATACGTGCTGTATGGTGGTTCATAAT
ATCTATATTTTAATGTTATCGAGCGAAAAAAATGCACACTAGTTTTTTTTCCACTTTTACACGGCAAAAAAGCGGTTTTCTAATACAACGTATCATGTTT
TTTTTTTAACCCTATCTTAATGTTACTGAGGCTCTGGATAATGGCCACTGGCTTGTGCTTCGTCTTGACAACCGACTTGTCCACCAGCGCATTGTGACCG
GTGATATCTCTTGACATCGCGAATACAGGAACTTCTGGTCCGTAGACTGCGGCTCGAATAGCTTCTGTACAGGTCAGTAGTTAAAGATATCAGAACAGAT
ACTTCACAGCAATTGCAGCAATACCTACCCAACTATTGAAGCTGTCGACTTGATCAGGAGGTGTCGCGATAGCTGGCGCGAACGAAGCCACCCACAGCGA
CACACACATGGGTGAAAAGCCGTACGCCGTCAGGTTCCAGACAGCTACACGTACGCAGAAGCGCACGCTATCACGTCCTGGACCTGTACTAGGGCTTCAG
CGAGGTGCGAGGTCACTGTTGTGTGCTAGTGCCACTTCTTTCATGCTTCGAATAGTAGCGCTTGCCGCCGCTGCTGTCTCTAAAACAGCGGCCTGAACCC
GAGAGTTTTCGTGAGTGAAAGCCGAAATCCGTTCTTGTGTTGCAGTCAGTTTTTCGAGGGTTAGTCTATGTGTTAACACGATAGAATCCCGGTGTTTAAT
TCTAGACAGCAACATACGCAAAAGCAATATTTGGGATAGAGTCGGATTGGAATACAATATGGTTGCAAGTTAATCCTTGTACTTTGTGGACAGTCATAGC
GTAGGCCAGTCGGAGCGGGATCCCTCTTCTTACAACACGGAGATCGCTTGATGTTTTACTCCAAGATACATCTTTAGGCACAACTGGTACAATGTTAGGT
ACACTTTCAAGCAGTGAAGGCCCTAAATACGCGTCAACGATTTGCATGAGAACAATTCACTGTTTGCCACAAATAAAAAGTCGTATACTATTGCGTTCGT
GCCGTTGCACAAACCAGCGGCTTGGGCCATGCTGAACGTTAGAGTGACTGGAGCTCCTATGCAGAGATTTAGCTTGCTTGCAACCTGACGGTCACGCTCT
GAGCTCGGTATTTTAGCATCCTGCAATAGCGCTTTGACAGTTCTCACAGGGATATCCCGCTTAGTTGTTAGTCTTTTTTGTTGGACGGAATGTTGTGCAG
TAAGATGCGCAGTCTTCATACCCGCACCCTTTATTCTGTTCTCGTTGGCAACGTCGACATCTACATTCTTATAAGCTATATGTTTTGCTTTTGAGACCCA
ATCTGACCTTTGACTTGGTTTTAAACACCGTGTATTGAATAGATTTATATCCTCGGGCGTCGGTGTCATTTCTCGTAATCGTCGTAACGCTGCAAACCAT
TCTGGATCCATCTTTCCTCGGTTTTGGCTTGTTAACATACAAACCTTGTCTATGCTATCCCAAATTTCTTTCCCACGCCGCTGTACATCGTTTGTGATTT
TTGACAAAGGCGTGGAAAGCGCGTGGGGTACTACGGGTTCTAACTGTGCCCCATCACCGGTTAAGTATACATCTCTCCCCCCAAACAACTCGTCGGAGTG
GCTAGGCTAGATTTCCCTCATTCTTCGATCGATCCAGTAAAGCATTCCGCACGAGATCAGACTAAACTCATCGATAATAACTAAGTGGACGTTTTTAAAG
CGCTGCTGCAAAGCTTTCAGCTTTGCTGGCCCCGATTTGGTTTCGGCTAAAGGCGTGTACTTGGCTGAAAACGCAGATCGACTGTAAGAAGCAAACGATA
GGACCGAGCAGATAGTCAATCCTTTGATATTGAAGGCAGCCGTACCTTGATGAGCTAGCAATAAGACCCTATTCGAAGTTCTTCGAGTGGCAGTGTGCTC
ACCAAACACGTTGTGCATGTCTTTTACGATGTGTTTTATTAACCAGCTTTTTCTAGACCCCCTTCTCCGTTTATAATCATCTGTAGCGGTTCACAGTGTA
AATTTTCCAGCGAGCTCCTAAAACGCTTTCGGGATTGCTCCATCGCTAGATTAAAAGGTGTCCACTGCGACTCTGCCATCAATTCTTCTTTGTCTGACAA
TTCGTCAGGGCTCTCAACCGGATATTGGTAAAGCGAGGCTGAGTTTTCTTGCTGCCGAAACAAATTACCTAGTGTCCGCGATTCTTTGTTCTCCTTCATC
CAAGGTTTCAAGCATGAATTGACGAAGTCTGTAGCATTTTGCGCGATTTGGTCGGTGTAATTGTGTCTTGGCTCCCATTCTTGATTATGGTTGTGACTGT
CATCGAATTCACTGGCGCTCCTGTCTTCATTTTGAAGAGGGTTGTTACTGGGGTTGCTAACGAAGACATATTCTGATGCTGGTAAAACAGACATAGTACT
AGCTGATCGAAATGTTTTACTTAATGAATCTAACTTCTGTTGTCTGTCCAGTTTTAAATTCGTCTCTTCTCTTAATTCACTGTCCATACGCATGTCTTGC
TCATGTGAAAAGCGCTCGATGCATTCTTCATCGGTATCC