Description :
From Genome Similarity Track
Location :
Scaffold_709:680- 2185
Sequence
1505 bases(100 bases per row)
GGCGGGGAAGGTTCGAAGAGAGATCCGCCGGCAGGTAAGCCTTCTGGCACCCGACATAGAAATTTGGGTGCAAACGCATAGTGGTAGGTATGTCTAGCGT
GTAAGCATCTCCATGTGCCTTAACAACCCGAAAGGGGCCAATAGATCTTGGCGCTAAATTATAAGCCCAAGTTCGTCGCAGATGTGTCTGGTAATCCTCT
TGTCGATAACAAGACTCTGTCACCTTCTTTGAACGTCAACGTGTTCTTTCGACCTCTCTTGTGAACGTTCTCCTTTCGTTTATCCACTGCTTTTTAAGGG
CATCAGGTACAAAACGTTCTCCTTTTGTTTATTCACTGCTTCTTGAAGGGCATCACGTACAAAACGCATGATGCCTTGTCGTAGTTATAGGAATTCGTTC
ACAGCAGCCGAACATACAGGTGAAGTGGAATCTTAAGGAGAAACATTAGATACTGGAGACGCGATAGGATACATCGCGACGGGACTCGATATGCCATTGT
CTACGAACTTAACAGCATAAGCTGCATCGGCAGCAACCTGATCTTTAACGTAATCAATCATCAAATTTTTCGGCGTAATACTATCGGCAGGTACTCCCCC
ACCAAGCTTACAAACCGGGTGTTCTGAAGCTGAAAGAGCAAGAAGCGCTGTAACGCAAGGGTGCCTCGCGTTGTTCACAAAAATGGCGTCAACCCTGTTG
ACGCATGAGCTGCATTATTGATTGCAAATTCAGCGAGTGGGACCAATGAACTCCACGACGTAAACGATGTCGCATAACTGCGCATGACATCTGCAAGCAC
TCTGTTCATGCGCTCCGTTTTCCCATCCGTCTCTGGATGGGCTGCCGTAGCTATAAGCAATCGCGTGCCTAATAGTTGAAACAACTCTGCCCAAAAAGTC
GACGCGAAACTCTATTCACGGTCCAAAACAATGGATTCTGGCAAGCCGTGATGCCTGAATATGAGATCGAGAAAGATCTTCGCGGTCGTCTCCACCGTAA
CGTGCGCGGAGACTGGATAAAATGAACCATTTTGCTAAATCGATCCACAAGAACCAGTACACCCGTGCATTTCTGTTCAGCCGGTGGACGACCAAAGATG
AAATCCATGCTGACCGAACGCCAGAATTCCGTGGCAATCGGAAGCGGTCGCAATGGAGATTGTGAATACGGCGCAGGCTTTACACGCTGGCATGTTTCAC
AGGAGCGTACCCATTTCTGGATGTAATCGTTCATACGCGGCCAGAAAAAAACACGAGAAATGGCCGCGAGCGTCGTTTTGCGACCCAGATGACCACCAGC
TGGAGTGTCATGAAATTCATGCACCAATCGTGCTCGGAGTTCGTCATCAGTAGGGATGAAGACGCGCGATGGGTCAAAGCCGTCCATTGTATACGTCAGC
AGCGGACCATCAAGCGCGTAATGCTTAAGTTGTTGCGCGTTGGTTTCGTCAACTTCGTGAGTGACCCTCACTAGGGTGTCGAAGGTAATTGGTAATTTCC
GTGTA