Description :
From Genome Similarity Track
Location :
Scaffold_1891:68- 3537
Sequence
3469 bases(100 bases per row)
CGTCTGGGTGTCTTCTTTGTGAGGAGCGCCCCTAGTCAGCGCCTCATCCATCTTAGCTCGAAGAGTGATGCTCGCGGCCAAGACTCCCAGGATCTCGTCT
TCCCCTTTCGAACATTTCACAATCTCCAGTGTCCAAGGCGAGAGTAAAGCTGCCCACTGTCCCAAACAGCCTTGTAACCCGGCCGACTTGAACAGCCAGG
CTAGCGTAGAGTGTCGGGTCAGGATCCGGATGGATCTTCCCACTAGCAGGTTGTAATTCAGATCCAACACGCGCAGGAGCGCGAGTATCTCTTTCTCCAC
CGCTCCGTAGTTCAGTTCATTCAGCTTCAGTGTCCGGCTGACGAAGGTGACTGGATAGCAGATCCCCTCATGTTCTTGAACCAGAGCTGCTGAGACTGCC
CAGTCACTGGCATAAACTATTACCGTAGGTTGACGTTCCGGATCGAAGTGACGGAGGATAGGCGTGGTCGCGATTCTGTTCCTCAGTTCCTCGAATGCGT
GTTGAGCTCGGATCCACCGAGATTCTGCCTGTTCCATGTTCTGATCCGTCGTCTCTATCCAGCCTGGATCCTCTCTCTGTTGGTCTCGGGGTGGATCCAG
CTCCTGTTTCAGGTCCTCTTCTGGCGTCCTACCACTTGGATCCCTTCGTGGATCCGGCATCTCCTGGGCCAGTGCTTGTTGGATTTTCATCTGGACAGCT
GGAGTGGTCATCGCGGCAAAATCTACCTCTCTCAATTCGTACAATACCGCTGCAAACAGGGCGTAATCCTCGATGAACCGACTGTAGTAGTTCAAACTGC
CCAAGAAAGATTGCATCGCCCGTAACGACTGTGGGAAGGACAAATCGTCTAGTGAAGACAGGCCCTTAGGATTCGCCTCCAATCCCTCCTTGGAGACTCG
ATGGCCTAAGTACTCCACCTTGCGCATCCCCCAATAGCTCGTTACCACACTAATAGAGAGATTCCACTTAGTACACGCCTCCAGTAAGGACGTCACCCTC
TCGCACAACTGATCCCACGATTCCGCCGGGATCAGAATGTCGTCGATGTAAGATCTGCGTCCTAACACAGATGGGGTCCCAGGATCCCCTGGCTCCCCCG
CTTCGAATGGATCCACTTCCGTATGGCCTTCCCCAGACCCACCTGTTTCGGACTCCGGTATTCGGGTGAATCCATAGAGGGCGTTATCGATCAGGCGTTG
GTAGATCTGGGGTGCGTTCTTCAATCCGAACGGCATCCGGCTCCACTCGAACAGGCCAAACGGTGTGATGAATGCGGATATTGCGCGAGCTCGATCCGTC
ATAGTAACCACCCAGAAACCACTGGCCATGTCTAGAGAACAGTACCAGAGTACTTTATCCAGATCTTCCAACAGCTCGTTGATTAGGGGCATCGGATACA
CCATCAATCGAGTCAGACCGTTAACCAGCCGGTAATCAATGCACAGACGTATATCCACCCCGTTCTTCTTAATGATGATTACCACTGGGGATGCCCACGG
GGACGTCGAGAAACTGGCCTTAATCAGGTCCGATAGTTTTTCCCGGAACTGAGGTACCACCTTCCGCACCCTCTGAGCGATCGGTTTCGCGTCGCCGACA
TCGATGTCACATTTGACTCCGCGGGCAGCGGGCGGTAACGCATTACCTTTACCAATCAGCAGATGTCGGCTCTCCCAGATTTTCTGACGCAGACGATCCA
CTTCAGCAGGTTCATTTGCCCCCGGATCCACTTGGATATCATCAATCGTGACTTCTTCTGTGGTCAGTGGTACCTCCGGGATCACCGCCATGCCTTCTCC
CAGATCCTCGGCGTGTAGATCCCCGCCTTCACGGTAACAGACTTGCTCATCTTCCGTCTTCGTAGGATCCACCATTGGATCCAAAACCGCGGCCCTCTCT
CGCCTGGCAGTCCTTCTATCTTCGGGGGTTCAGGTACCCTGGTATCAGGGAAACCACCAGCTGGATCCAGTTGGTCCTCTAACGAGTTTGAGCCCGACAG
TTCGGGTTTGACTAGTGTTGCCACTCTCGATAGGGATCCGGGCACTTTATTCAATGGAGAGCTTGGTTCCACTTGTGGATCAGCGGAATCCGGCTGCTCG
GCTGTAGCCTTCTGCAATCCTTCATCCACCGACCCTGCGTTATCTAAGGGCCGACTCTGGGGATCGTCCCCCGTCCTGGATCCAACTTCCATTGCTTGGA
TCTCAACCCGTCGATCCCTCTGCAGGATCTTTCGCGGAGTTGGATATGAAGGCCGATCCACCAAGGGGCCAGTTGGCTCCCCCGGGAGCTCCACCTCTGC
GAGAGATTCGATCTCGGTAGTCGCCTCGTACACCAGATTCTGCCATTCTTTGTAGCGGCGGGATCCCACTGACACATATCCAGGTCGTCTAGGGATACCG
TCCTTCGCCAATCATCGTCCGATCTCCTCATAATGGTCCAGTAATAATCTCTTGTCGCTGACGTTCGTGACCTGGAGGTATTGCGATCGACCTGGTCCTT
GGATTACGGTAGGTACCCATTTCTCGCCCCGAGTGACCCACAGTCTTTCATGTTCCACCCACTTTAACCGGTCTGGCAGCTCCCAAGTTTCCCTGGGCTC
GATCCAGGTTGTCTTATCCGCCCTTATGATCCTCATCTTTGCTCCATACAACGGTCGCCGTCCGCTGAGCTGGATCCGCATCTCGTCAGGGAAACAAAGT
GTCCCATCCGCTAGATCCAACCTCACTCCGGCTGGTACCATGAAATCTATCCCGAGGATGGCGTCTTGACCAGCGAGATCCCCGACCCAAATGTCAAACC
AATACACCAAACAACCTGCCAGCGTGATCTTAATCCGCGTTCTCCCGTTCGTACGGTACACGCCTTCACCAATCCCAACACAATCTTGGATCCGACTCCC
ATCCACTTGGCACCCAACCTTACGAGCAAAGGCGGTATCCAGTATAGACACCTCGGCACCACTATCTAGGAGTAGGATTGCTTTTTCATTGTTGATCTTG
CCCCCTACCTTGGCTTGTCTGAACCACTTTCCCGGGGCATGGTACTTCCAGTACCCACGGGACTCTCCTGTTAGCAGATCCATGGATCCAACATCCTCAG
ATCCACGGGATCCAGTGACCTGACAGACCTTAGGTGGATCTGCAGTGACTTCACCCTTGGTAGGCTCAAACCATCGACCATGTTGGCGTTTCTCCCATTA
ACCACGTGCCTCTCCTCTGTGTAGATCCAGGGTTGAAGAGATTTCGGATCTGGAAAACTCATCCACTTGGCGCAAACTAGAGACCTTGGCAACTGACACT
TCATGTAGATCACGTGTATTATCGACTGGATCTAGGGTCCTGCTACCTGGATCTAGCGATGTCTTGTTCACAAATGCATAAATGCAATACCTAGAACGCT
CGGCTCGTACCGGATTCAAACCCGGCGAGAGTCCTAGTTTAACATCTTCTCGGCCACTTCTGGCAACAT