Description :
From Genome Similarity Track
Location :
Scaffold_449:68- 2629
Sequence
2561 bases(100 bases per row)
TCTACCGGCCCTCCGGCGCTACCTGCCCCGGACTCATCACTCCCTGCGGTAGCTCCTGCAGCACTCCCCGTCGCCGCTGAATCCACGGAGATGGCTCCTG
CTGCTCCTCCTGCGCCTGCTGGTGGTACACCACCACTCACCGAAGATTCGCCGCGCGCCATGCTGGCTGAAAGTACGGAGGCATCGTTCGATCACATGAT
GACCTCAATAATTCCGTACTTGACTGCAATGACTCGTCACCAAGTGCAGCTCAGCGTTGCGCCTCCTCTCCACGGCGATGTACACACTCAACGTCGCCTC
GAGACGGCTGTTGGTTTCGATGATGTCCTCGCTGCGGTACAACCTCTTCCTGACGCGCTGTCAGCATTACCCGAACGAGTCGCCGACTTGGAGCGTCAGT
TGCGGTTTGCTCAGTCCGAGGCTGCTGCCGCCGTACGTTCGGTGGCACCCGAAATCATGGCTCGTGAGAACGCGGAGGCGTTCCTCAAAGCTGCCAACGC
TGAGATTGAAGCCCTTCACCACAACGTCAAAATTCTCCGCGAGTCGAACGCCAAGAACGACGCCATGCTCGCCACTGTTCAAGCCACTATGGAGCGATAC
GCAGAAGACTTGAATCGTCTGCACTGCGAGGTCCAAGCTCGGGGCGTTTTCATCAGCACGTTGCACAAGAAGCTGGCTCGCGAACGCGAGGTGTACAAGT
CTTCTATTGGAGCGAATACCGAGCAGACTCGGAAGCTTCACCTCCTTCTGGTAAAGCTTACCCAGGGCAAGTATGTTGATAACGACACGCTCAAGGTCCT
CGAGAGCCAGCAAGACCGTAACACTCGCCTCCCCCAAGCGAATCGCACCATCCGTGCACACGTGAGTCTGGCCGGGATGGATCCCGAGGTGCTTCGTCTG
GCTGTTGGCTAATGTCGCTCCTTCCACCGTGTGTTCAGCAACTAACGTTCGTTCACAATCCTTCGTGATAGGTCTGACTGCGGGTGAGCTGGACCTGGAC
GCGCTGGACTTGGATCAGGAGACGATAGTCGCTTTGCGGCGCATCCAGTCTGCTACCGCGTCTTCGGACGATCCTCAAGCTCTTCCTGCCGCTTTGGCCA
AGGCCGCTCATCAAGTGGCCCATGGGAAGTCCATACGCGCCTTCGACCAGGTGGCGAGGATTCTGACGACGAGGCAGACGACTCTGACGAAGACAAGGCT
CCAATCCCGACGGACAAGGCCAGTACTTCGATGGCAGCTGCTGGTCTCGGTAATGCGCCACCTGCCGATACTTCAACTCCCAAGTCGGCTCGTAGATCGC
TATTCGGTCCGAAGGCGTGGAAGAAGACGGCCCAGAAGAAGCGCAAGAAATCTCGTCCTCATTCTCCTGCCAAGTCGCCTCGTCGTCATATGAAGACTCG
GTCCAAGTCTGTACCGTCTTCTCCAAGTTCATGGTCGCCATCAGCGTCTTCCTCAACTCCTGCCGTGGTCGACCTCAGCGGCGATCAGAGTGACGTGGAC
TTGGGGAATGCTGATCCAAGCAGCGTCCCTTCGGTTCAAGAAACTGCTACAGAGCCTTCGGGTAAAGAGGTGGACCCTGGGGATCATAACGATGTTCCTG
ATTCTCCTGACGCGCCTTCGCCCCCGCTTCAGGGACCACCCGATGTGGCCAAGCCACCAGCTTCAACGATTTCTCCTTCTCCAGCCGACATACGTGCTGC
GGAAGAAGCTCTGCGTGAGGCCGAGCAAATGCGACTCATGTTCGGCTCAAGTGATGAAGGTGAAGAGTCGGACCACACTGTCCCACAAGGCAAGTCTGCT
TCGGCGTCCGTTGCGACGTCCAAGACAGTTGAAGTCTCGGGAGTGGTTTCTACAGTAGGGTCTGCCCCTGTTCAAGCTGCTCCACTAGCCTCCGGGTCTT
CAAAGCCGGCTCCGGCTGTTCCGACGGCTGTCGTACCAAGCGTATCTTCGCCCGACTTTTCGATGGAGATTGATGACGATGGAAATGCTGATGACGATCG
TGGAGATGACGTGGATGATAATGAACCTTCGGTGGATGATTCTCCTGATGCTCCCGGTGGTGGCGGTGATGTTCTGCCACCTACCGATCATTCAAGCACA
CTCGATGACGAAGATATTAAAGATTCCGAGAGAAATTGGAGCAATCTTGGCCCAGCTCGTCCTCCGCCTCCACCTCGGCCCAATCCTTCGCCGATGATGA
CTTCTCCAATCATAGTTGCCGGTCCGCCTCCTTCGCCACCGGCAAGTCACTCAGCACCAGCATCTTCTCCTCTTGTTCCGGTGTCTCCTCGTCCGCCTAT
TTGGACTCTTGATGCTGGACCTGGGTGCATGATTACGGCCACCTACACCTCGGTGCCGCGTCGTGGTGGTGCACCGTCGGTTGAGCCGTTGCCTCACCGA
GTGTTGTCTGGTGGTCGCCCTACGGTGCCGGCTTCGTCCACCTTGCCACCGTGGGTTCTTCCGTACGTGGACATGGCGTTTACTGACGCAGGCATGAAGA
AGTGTTTCGAGCGACTCTTGAGCTTAACCCTTCCCGAACCAGCTGGTGAGGTGACCGTGCG