Description :
From Genome Similarity Track
Location :
Scaffold_2501:68- 2000
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_2501-snap-gene-0.1HEAT repeat containing 5B

Sequence
1932 bases(100 bases per row)
TCTGTGTTAGCAGCCGGTGCGTCGTTTGCGCTCGCCTGTGTCAAGCGCGTGTGCGGCTCGGGCATCACTGTGGACTCGGGATTGATTTTCCGATTTGCCG
GCGAGATCGAACAGCCTTTGCGTACGTGGATTCTCCACGCATGGAGTATCATTGTGGACTCGGTGAGTGCAAGCGGTGGGGACTATGAGCAGTACGTCAA
GTCGAGCGCATCGCTAATCGAAGCCCACCTTGTGGCCGGATTCAAGTACTCGAACAAGACCAACAAGAAGTGGCTGCGCTGGCACATTAGTTCTCAAGTA
TCGATTGGCCGCATCATCAATGGCGTCGTCGCGACGCTTGGGCCCGAGCTCGCAACCTCAGGTGAACTGCTGACCGATTTTTATACGCTCTGGGGATTGC
TGCGACAGGATGGTTATGACACACGGGTCGAGCTCGAGTACCTCAAGTTCATCGAGCAAGTCGTGGTGTTTGCGCCGGCGCGGTTTGATGGAAGTGATCT
CGTGTACATCCTCAGCCTTGTCTCGGACGTGTTTGTAGGACCGGCTCTTGCGAATGATGCGGTCTCCCCTTCGTCGGTGGACTTTGTGAACGTGTCCTCC
CCCAGCAGCGAACTAGGTGACGCACAGTCCGGAGCCTTTGGAGGCATTAGCTACCCCACCAAGAACGTGCTCGTATGTGTGAACGGCCTCGCGCGCAACA
TCCTGCAGCAAGTCGGCATGTCGTGTCTGCGTACACTCGCCGAGCGGGACCCGGGAGTGATTCGCCGGTACAATCTGCAATGCCTTCTCTTCCACGCGCT
CCACGTCGAGTGGAATTCGTTGCTGTGGCGGTACGTGCCCGGTCTCCACGGTATGTGGGATCTACTCTCGTTCAAGGTCTATGTCCCGTGTAAGACACGC
GACGGACTCGGTGAGATCCAAAACACGATTCTCGCTCTCATCGACATTGACGGCGGCAACTGGGGCAGCTGTCAGCCGTGTGTATGGGCGTTGTTTTGTC
GGGGTATTGCGATGGGCGAGTCGAGCAGTAGCGTCGCGTCGACCAACGAGAACTTGATGATGAGCCCGAAGGGATTCGAGATGCTACCGATTCCAGGATC
GACAACAGATCGAGATGGCTCTGGGTGGAGTGCGGGAGCCTCCCAAACGTCCGGGAAGACCGGTACCCACATCGCCACCGGCGCCGTGACCGCCCAAATG
GACACATGGAGACGCACGAAACGCCACGTGCGCGGACTGCTGTCGTTGGTCCCACTTCTCTCGCGACAGGTTCGTCGCTTTGCCGTCGCGTGTGTTGTTC
GCGTCTTTGAGCTTGTGAGCCGTGGCGGGGAAGTCGACGTCAAGCCACATTTCGATCTCGTCGAAGCGCGCGCGCGTTTTCTCGAGAGCGTCTCGATGGC
GGCTGCTACGACCAGCGACTTCCATGCCCAGCAGCTGAGCCATCAAGCTAGTGACGGCACAACGCAGAGCGGGCTCAATTTTCTCAGCATGTACGTCGAC
GAATTCGTCACGCTGGCATGCCACGCGACTACGTCTTCGGCCGAGGGCAACGAGCTCCAGATCTTCCAATGCGATGGCCTGCGGCTGCTAAAGGTCGTGC
TCACGAAATTCGGCAACGCGCAAGACCCCGAAGTCACAGGAGAGACCGCCTACTTGCTGGACCCGTACCAAGCGCAAATCTCGTCGGCTGTGCGGCACGC
CGTCAAGCAGGCACAGCACTCTTCTGAGGACCACGACGATGACCAAGACTTTTACGCGCCACTCGCAGTCGAAGCCTTTTCGCTGTGTGGTGAATCCGTG
CGGAGCCGACTGGTGCAGGACAAGGTCGCGTTTGGACGGCTGCTGCGCATGGTCATGACCAAGGACTATGGCCACGGCCAGCATTTCGCAGGTGATGAAG
TCACGCGCGTCGCCATCTCGCTGGCCAACCTG