Description :
From Genome Similarity Track
Location :
Scaffold_45:68- 1888
Transcript NameFunction/comments
Hyaar_Emoy2806011endo-1,3(4)-beta-glucanase, putative

Sequence
1820 bases(100 bases per row)
ACCCGTAGGGTCTTGTCGTTAGCATCAGCGTACATGCCGAGTAAGACATAGAGCGCCGAGCATCTGTCGACCAAGAGTAAGAGCGATGAAGAGCCACAGG
CAAGAGGCCATCAGATACACGGGTAGTCCAGATGGAGTATGGCTCGTAGCCATTCAGATTGATTTAGCAGCCAGTACGTTAGTCAGGGGGTCACGCGAAG
TTTAACCAGTTAGGTAGGGATTGGTAGACTATGTCAAATAGGAGCCACGCACTCGACCTCTGAGGGGCCGGCCATTTACAAGGGAGATCGGTGCAGTCGA
TACCAACCGCGGGGTGAGTCCCGAGTAGTTCATGGAGGCGTCCACCAAGCCGGAAACAATGTCGGACACCATGGTGCCACCAGACGAGCTGGCAGTGAAC
TTGACCGTCACTCCCTGGTCCGCCCAATCAGTAACTTGGAAGGTGGGCTTCCGCCACAGGATTTCTTCAGCTGAAAACAAGAACTCTCGGACCATACCGT
GCGCATAGTACTTGACAGCGCCGTTGTTGCCGGAGCTACCGCCACTAAAGCGACTGCGATACGGGTAGCTCGCGGACATGCCGAACGGAGCCTTGTCGAC
GACCATCTGCAGGGAGTACGGGTTGGACCAAATGGGTTGGATGGCCGCATTCGAGTCGTGTGCGATGATGTTGCCCCACCAGTTGTTGGTTGGGATCGCG
CGGTTCTTGATCACCGATGGATCAAGGTACTTGGGTGGACACAGGCTCATCATCGCTTTGGTGCGCTCGAAGAGGTTGCTGGGCGGTATCAAAGCGCGAA
ACTCTGAGGGGGCATTACCACCTACCTCCGTAGGTAACAGGTCTGATGATACCAACATATTTGCGTCGCCACCATCCGTCACATTTGAAGTGATGTTGTT
GAGTGCAGGTGCAAACGTGGATGCCTCCACATGTGAGCTATCACTGAAGATGATAGATTCATTATCATCAAATTCTTGACCGGCAACGTGAACAAGGTGA
AGATGCTGAAGAACCGTGCCGATGCCGATTAGAGTTGCCGCAGATATCTTCATGCTTGTCCGTGCTGCAGTAAGATAATGGTGTTTTCGATTGCGGACAG
AGCTTCGAACTGATAAGTGAGCTCTAGTGTCTGCGAGTGCACTAGGTCCCTCAGGCATTGAAAGGATTACATCTTTGATGTCTAGCAAGCGTAACGAGAA
ATCGTAGACCAAGTGCGTCAATGTTCGATGATCCTGCCGCATAATTACTATAACTTCCTCCTTGTATGGTCCCTCGGCACCAGTTAAGTCTATCGACAAA
ACGTCTTTTGCAAGCTGTGCCTACTCAGATGTAACCGAATCATCAGCTACAATAACGGTGTCTTGTGCGCTGACCAAGTTTGCTGCTGGAGATATACTTC
AAGTGTGCATGTAAGCCTGATTTTGATCCAGCGTAGGTTCATTTAACTCTAAAACGGGTGGCAGACGTTACATTTTCCGACCTGTACTGACTTCGCAGTT
TAGCCACCAGAGCATCATAATTTGAAACGCGATATTGTTCAAGTTTATCATCCTGTCGCTTGACACACGTACGCAGTAGCCCGTTGCATCATGTCGTCTC
GGTTGTTACGAAAACCTTTTCCGGAATAATTTGATAGACCTGTGATTCGAGCACGTATAGCGTTTTTCTTATGGAAAGTTTGATTGCTAATTATCGTGCA
ACGGTAGTGTCGGAAATGGGAATATAGGACAGGGATTCGATCGAAATTGCTCTCGATTTGAATGCCTGGGACCGAACCTTGACGGCTAATTAATGTGGAA
TTGACGGAATCCATTGGTGT