Description :
From Genome Similarity Track
Location :
Scaffold_3131:68- 1782
Sequence
1714 bases(100 bases per row)
GCGGATCCTCAGAGCACCAGACCGAAGAAGCGTGGATCTTGGGACTAAAGAAGTATCTGATGGGCGATGTACGAGACCTGAGTCGGGAGGGATACCAAAT
CCTACAGTATTATCGCTACGGATTACGCAATGGATCTGAATGACTTGCTCTTCTATTGTCCCCCTACGAAGAAAGTCGACGAGGATCGGGATGGATTGAT
GAGACTGGTGATGCCGGAAACCTTACAACAGGACGTGCTACATCACTATCACGCTAGTTTAGAAGGCGGACATCAGGGTATTGGTCGGACCTACCAACGG
ATCCGGGAATGTTTCCACTGGAGGGGACTATTCAAGAGCGTACAACGATATGTCGGTGAATGTGTGGATTGTGAGACAGGCAAGGGCAGACCCACAATCG
AAGGGGAGTCACCTGGGAATGTCCAAGCGACTTACCCTTTCCAGATCATAGCCATGGATCACATCCCCTCGCTGCCCAAGTCGTTCAAAGGAAACACAGA
ATTGTTGATTTGGGTGGATCTGTTTACCGGATACGTGATAGCCAAAGCTAGTGCGTCTTGAACTGCGCAAACCATTGCCGAATCGTACGAGGAGTGCGTT
TTCCGAAGATTTGGGGCTAGTGAGATGATTAGACATGATCGGGAGCCAGGCTTTATGTCTGATTTCTTTCGAGCTTTCAACCGGATCCTGGGGCAGAGAC
AGCGGGCAACCATGGCATATCATCCCCAAGCTAACGGATCGGCCGAGCGCATGGTGCAGACGATTCACGAAGGCACCCAAAGATGTATGTCCAGGATCTG
GATCAGAGGGATTTGGATGAGTTCGCAGAGCGACTCCCCCTTCGCGATGAACACCGCTCAAGACAGGATCCCGGGGCGACACCCCCATTTTACTTGGTAC
ATGGGTGGGATCCTAAATCCACCCTAGAAGCAGCCATTCCGGTATGTAGCACCAAGAAGAGAAACCGAGATCCAAGACGATGGCGATACCAAGTCCAGAA
ATACTACCGGCAAGCCAGATCCCAAGTGAACGAACGGCTGCGGAGTGCGATACAAGATCGAGCGAATCGACACAACGAAGACGCCCGTCTACATCAAATC
CAAGTGGGATCGCAGGTGTGGCTTTATTTAGATCGGGTGAAGGAAGGGTATGCCCGCAAATTGGCCTATCTATGGCACGGACCGTTCCGTGTGATCGAAA
AGATAGGGGAACATACGGTGAAGTTGGAAACGGCAGGTACCGAATATCGCCTGTTCCCTGTAGTACACGTATCCAAGCTGAAGTTGGTCAAAGAATATCC
AGATCGGCCGCAAACCCGTCTTTCGGTGGATGGATCCGACCGGGTAGACTTCGACGAAGTCCTCCTACCGGAGGATAGTTGGAATGTGGACCTCGAGGCC
GACGAGTTCGATGTCGGGAAGATCACCGACATGAGGTCAGGGAAGAGAACTAGATACAGACGGATCTACCGTGCATTTCTGGTGTATTGGCGTGGATATG
ACAAACCCAGTTGGATAGACGAGGCAGATCTGAACTGTGGAGAATTACTCTATGGTTTCTTGCGGGATCGTACGAATCGTAACAGATTCGGCGTGATGCA
GTCTCATGAAGAAGAGTAGGAAGGGGATCCGTTGATGTGAGTTGGTCATATCGATGGGAGGATGAAAAAGGACCCACAGGAGGGGTGTGGGCCAGGAGGG
AAGGATCGCTGATG