Description :
From Genome Similarity Track
Location :
Scaffold_2838:68- 1471
Transcript NameFunction/comments
Phypl_g15430reverse transcriptase

Sequence
1403 bases(100 bases per row)
TAGGTGCCCTCGTGATCCTGTACAAGGGAAGCCGATATTGCCCATTCGCTTGCGTACACGATCACTACAGTCCTCTTTCCCGGATCAAAATGCTTGAGTA
TCGGCGTCGCTCCGACCTTTGTTTTCAGCATCGCAAAGGCTGTCTCGGCTCGGACCCACTTCGAGTCCAACCGTGGTAGGTCTTGACTCTCTAGCATTGA
CGTACCCTCTTCCAGGTCTAGATCAGCCGCGTCTGTTCCGCCCATCCCGCCGCGGTTGGCACGGATGGCGGCAATATCCACTTTCCTCGGCTCATATAGC
ATCGCCGCGTACACGGCCAGATCCTCGATGAAGCGGCCGTAGTAATTCAGACTACCGAGGAACGACTGCATTGCTCGTAGCGATGTGGGAAACGGCAAAT
CCACCAGTGCTTTCAGATCCTTCGGATGTGCTTCCAACCCCTGGTCGGATACACGGTGTCCGAGATAATCAACCTTGTTCAGCCTCCAGAATCTCTTTGT
TACACTAATCGACAAGTTCCACCGATTGCACGCTTCTAAAAGGAGTTTCACCCGCTCACACAGCAGATCCCAGGATCCCGCGGTGACCAGAATGTCATCA
ATATAGGATCGGCGGCCGAGCACGGATGGCTCCCCCGGCTCTtccgcagctcctccgtcgaAAAGATCCGTCTGTGGTCCTTCGGCCCCAGCTGCGGGGA
TCCGGAGAAAACCGTATAGCGCATTGTCGAGCAGTCTTTGGTAGATTTGTGGGGCGTTTTTCAACCCAAACGGCATCCGATTCCACTCAAGCAAACCGAA
AGGTGTGACCAATGCTGAGATCGCGCGGGCCCGATCCGTCATCGACACTACCCAAACTCCACTTGCCATGTCCAATGAGCAATACCACAGCGCTTTATCC
AGATCTTCGAGCAAATCGTTGATCAAGGGCATGGGGTAGATCATCAACTTGGTGAGACCATTGACCAGGCGGTAGTCGATGCACAGCCTGATATCCACGT
CATTCTTCTTGATAATCACCACGATGGGCGAGGTCCACGGGGATGTGGAGTGTCGGATTATCTTCGCCGACAACAGTCCCTGCAAGAGATCGGACACTTT
CTCACGATAGCGGGGTGAGATCTTTCGTACGCGTTGAGCTATCGGTTTGGCATCTCCGGCATCGATGTCACACACAACTCCAACTGCAGCGGGGGGTAGA
GCATTGCCTTTGCTGATCAGCAAGTGTCGCTGTTGCCAGATGATACCCCGCAGTTTGCAGATCTCTTCCTTCGTGTTCGTATCTGGATCTACGACCTGTA
GATTTTCGATCCGCACCTCCACCGTGCCAGATGTCACTTCTGGAAGTATGGCTAGCTCGCCTTCTACTTCTTCTGCATGTAGCatgccgccgtcgtggtg
gca