Description :
From Genome Similarity Track
Location :
Scaffold_43:6798- 10066
Sequence
3268 bases(100 bases per row)
CCAAATTGAGAGAAGTCGTGCTTCAAATTGAGAACCGCCAAAAGCAAATTGAGAAAACCTGTATTAACGTATACTTATCATTGAAACGAGTAGTCCAACA
CAGCTGCTTAAGAAATAACAAGAGTTTTATTGCATGAAAGTAAAACCACGCATTGTAAATGATAAAGTGTAGGTATTATTAATAAAGGTTATATTATTAT
TATTATTAAAGGTTATGGGTAACCGTGAGCTCGCCAAAGCACATTCCGATTAATCTCAGGCTTTGCTCACCGGATGTACACTGCGACACATCTGAATGTG
CCTACCGGTGTACACTACGTGTACCTACTTCGCTGGAAACGGCTTCACTTTGCACCTTTCTGCCCAGCACTCAAAACGTTCGTTCGACTTCTCTCTGTCT
ACCTACCGGTACAATGCGGGTGGGATACGTCCCCTTGGTGGTTGCTGCCACTCCTTTCGCGAGCAGCGAGGTCTCAGCGACCCAGGCGAAGCTCACTCAA
TTGACAGCCCCAGCTGATGCGCAGTATGCAAGCCAGCGGTTTCTGAGAACGGTTACTGCGCGTGGCGACGAAGATGAGGAGAGGAAGTGCCACCCAACCG
GTTAGTTTTTTTATGATGAGGGGGGGGCTATTGTGGTCTCTTATACCCCTTTTCCGGTGGTCATGCACATTTGTCCTTGAACTTCAATGCGTTTTTAAAA
CAACCTCGTCTTCAGAGTGTTGTCACGCGAGCTCGTCACGGTGCAAACTCACAGTCAATGCTACTGATCCCAACCAAGTAAATTGGCTGAACCGTTATAA
TAACGTTTTCTGATTTTCCTAGCATCAACAATGTATCAATTTTCTGACTATTCATGGTGTGTGCAGCTTTTCAGTACTGTACATGTTTAAGGATTAAGCC
TTACAAGATTCATGCAGGTATTAATACATGCATAGGCAACCCGGAGCGTTGCTCCGGGAGGGTACACAGGTCGGCGAATAGTTTCATGGACGATGATAAC
GGATAACAATTGAGTAAATCCCAAAGTTGTGTTGTTTTTAATCCTTTAACCCCCGCACTCGCGGATTTTAAAAGAGCACTACCAGCCGAACTCTCTAGTT
GATTCTAACGTGGGCATATACTGCGCCTGCTTCGCAGCCGCAGCATCTGCCCGGGAATAACACCCTGGTCAGCGTCCAATGGCTGCGTTGACGCCAGCAA
CGAGAGAGCTATTTCATTCAGTTTGCAGGTAAGGTATACTGTGCTCATTTAGTACTATGTTGTGTGCTAACGATCAGTGTCACTGTCGAGTTGAGCTGGT
TGGTTTGGCGAGAGACACGAGGTTGGGCATCTTCGGCTAAGTGATTGAGTATAGAGCAAATTGACATGTGAAAAATGCAGCCTGCAGCTAGACAAGTCAT
ATTGGCCATCTTCAGCTAAGCTTGGTCGAGTATGGCGCAAATTGATACGCCTTCAGCGAGGCCATAGTGGATCCTACGTAAACCTTTAACCCTTCGCCGC
AATCCCATCTGTTAAATAGCCAGCTCACAAAGATTTCACAGCACTTCGGGGGCCACCAGATCGCCTCACTTCGCAACTTGCTACCAAGTACAAGGTATCT
GCCAACCAACAATGCGCCTGAGTCACGTCCTTTTGGGGGTCGCTGCTTCTTTCCTAGCAACCTGTGGTGCCACGCCTGCGTCAACTCAGACCAAGCTCTC
TCATGAGACCGCAGCGGACCATGTTCAGTCTGTGGAGATCGACAGCCCAAGCAAGCGCTTGTCTGAGGACCACCGAGACGGCCGCCGCCGTGGAAAAAGA
CGAAGACAAAGACGAGGAGCGCGCCTTTCAGGTTCAGTTCCTCAACAAGCTGAATCTCCCGACGTACTTCGGCAGCCCAGTCGGAAAAGATGGAACGTTT
ATCAAGACCTTCGTGAAGGCGCTGCTGAAGAACAAAAAACTCCGGAAGAGGACATTCCAGGATTGGGCAACGGCAAACCTTGACGGCAACATCTTGAAGC
AATCGCTCGGAGGCTGACCGACAAGTACCGAGTTCAGCTGTTCAACAGATACACTGCGTTTACGGGAGAGCTCGTCCGTCGGCCAGGTAACGATTTGGTA
GGCGAGGGATGGATGATTCTGGCTCGCGTTGTAGCTAAATAAAATAAGAAAGCGGTAGCTTTCATCTAGCGACTTCTGCCATACCTTTCGCCTTTCGAGC
GTTTTTTTATATTTCTCTTCAACCATTTCCCACTGCTGGTGCACTGTACATACTCTTGATTAATTAATCAGAGTCTCTGATTCAGAGACAGCCTTTTCTG
CTTCCATTACAAAATTTGTGAAGTTAATTGGCGAGCTCCACGCGCCACTTATCGGTAAAGAAATTTGCTGGCATGTACTATAGGACTGCTTTCACAGCAT
CAGCACTGATCACGGTGCATGTATTGCTGCAAAGCTCACCTGCAGTAGTCGACTGTGAGAGGCCCTACTTGCCAAGGTACTTTAAACGCTGAGTAGACGA
GCGATGCGTCCGAGTAATGTCCTACTGGTGGTGGTCGCCGCTCTTGCTGCAAGCTGCAATTCCTTCTCGGCGGCAACAACCGAGTCGACCCAGAACAACT
TAACCCCCCCCCCCCCCCCGTTCGAGACGATTGAAAACCTAAGGGCAATGGTCATGGATGCCACCGACGCTGAGGAGAGTAGGAGGCTCCAGCAACTTGC
CTGTCACCGTTGTGGAGGGCCTACTGATGAATGAGAGCCATCGAATAACCTACTTCCGAGAGGCCAAGCTCAGCGGGGCAGGCCTCGTTGCTCGACGACC
TGCTGGACCGCAGCATGATGGAGCAAGCTGCCGTGTTGAGGTACCGTACATACCAAATCCAGCGCTTAGCGTGAAAGAGAGGAGGGAGTAGAAGTGTTAT
GCGTTGCTGTGTTCGTATCGATATCGTATTACGGGGATAAGAGTCGTATTTTGCGTCATGATGAGGTTCTCGCCGCGCGACTGAACAGAGAGATAGAACG
GTAACTCTCCATCCACAGCACGTGCCTGCATGGGGGCTTGCAAGGTGACGAAATTGGTCCCCGCAGGTCGGTTGATGTGTTGATGTTGGGCGTGTCGAGA
GTTTCTTTACAATAGAATCGATACACTGTAGTGACGACCACAAGGTTGAGTCGATCAAATCGTTAGGAAACGACGCAGCTGGTGGCTCAACCGTGGCTGC
TGCGACGAGCGCCACGATGTTCACGATCCCGGATCGTTTACTTTCCTGCGTGCACCGCGCTCGTGCAT