Description :
From Genome Similarity Track
Location :
Scaffold_248:6798- 9032
Transcript NameFunction/comments
Phymu_g7488hypothetical protein PHYSODRAFT_346539

Sequence
2234 bases(100 bases per row)
GCCGTAGTATGGCGTCTATGGGAGGGCAACCGCAGGCCTGGATTAACCCGCAGAATATCCCGAACGGCGAAAGTCTCAAGAAATACGGGCGGGACCTCAC
CGAGATCGCGAAATCTGGAAATCTCGACCCTGTGATTGGTCGAGAGGATTCTATCCGTCGAGCCACGCAGATTTTATCCCGCAGGACCAAGAATAATCCG
ATTTTAATCGGAGAACCGGGTGTGGGCAagactgcagtggctgaAGGACTGGCGCAACGTATCGCGCTTGGAGAAGTACCGGACAGCTTAAAAGACAAGA
AAGTGGTGGCTCTGGACTTGGCTGCGCTAGTCGCAGGGGCCAAATTTCGAGGAGAATTCGAAGAGAGACTGAAATCCGTACTTAAAGATgtggacgacag
cgacgggAAGGTGATTCTGTTCATTGACGAGCTTCACACGTTAGTGGGGGCTGGCGGCAATGAAGGATCTACGGATGCTGCGAATATGCTGAAGCCTGCG
CTGGCTAGAGGCGCGTTGCACTGCATGGGAGCGACGACGTTGGACGAGTACAGGAAGTACATTGAGAAGGACGCGGCTTTAGCGAGGAGGTTCCAGCCCG
TGTTGATCTCCGAGCCAAGCGTGGAAGATACAGTGACGATTCTGCGTGGACTAAAGGAGAAATACGAAGTGCACCATGGCGTGAGGATCGCTGATAGTGC
actggtggctgctgcgacgcTGGCGAACAGGTACCTGACGGAGAGGAAGATGCCTGATAAAGCGATTGACTTGATGGACGAGGCGGCGTCGAggctgcgt
ctgcagcaggaaagCAAGCCGGAACCGATCGAGAAATTGGACCGGGAGATCATTCTGAGGCGGATTGAGATCGAAGCGCTACGGAAGGAGACGGACTCCG
CTTCGAAGAAGCGTTTGGCTGTGttggaggacgaggtgaagaaggcgtcggaggagctgcgtgaaCTGATGGACGAGTGGAACGcggagaagcacaagct
ggaggagatgcaggaCGCCAAGCGTCAATTAGAAGAAGCTCGTCGCGATCTGGTCGCAGCGCAGAATTCGGGTAATTACGCCAAAGCCGGAGAGCTGATG
CACTCGACCATTccgaagctggaggcggaAGTAGCTCAtgaggagcaggaggaagaagagacgaagaaggcgggAAAGAGCAGGACGTCACTTGGAGATG
CGGTGACAGCTGATCACGTAGCGGAGGTGGTGGCTCAGACCACTGGCATCCCGGCAGCCACTTTAATGGAAGGTGAGAAGCAACGTCTGCTCAAGATGGA
AGACCACATCAACCAGCACGTGATCGGCCAGGAGGAAGCTGTCAAGGCGGTCAGCAACTGCGTGCGTCTCGCGCGTGCTGGACTTCACGCACACAACCGT
CCGCTTGGTGTGTTCATGTTTTTGGGGCCAACGGGTGTGGGCAAGACAGAGCTGACGAAATCTCTATCCGAGTTCCTATTCCAGACGCCGCAAGCGCTCA
CGCGTATCGATATGTCCGAGTACATGGAGAAATTCAGCGTCAGTCGTCTCGTGGGAGCTCCCCCAGGATACGTCGGGTTCGAGGAAGGAGGAACTCTTAC
AGAAGCGGTGCGACGTCGTCCTTACCAAGTGGTTCTtttcgacgagttcgagaaggcgCATCGGGACGTGAGCAATATCCTGCTTCAAGTGCTTGACGAA
GGCCGGCTAACAGACTCACAAGGCCGCCTCGTGGACTTCCGCAATACCGTCATCATCCTTACGAGCAACCTAGGCTCCGAGATCCTTGCAGGGCTCCCCG
AGGGTGCTCCCAGTGCTTTGGCTGAGAACGACGTGATGAATGTTGTGCGCTCTCATTACGCCCCTGAGTTCCTAAACCGAATTGACGAACTGGTGCTGTT
CAACCGTCTGAAACGCGAGGATATTCGCTCTATTGCTGACCTTCAGTTGCGCCAGGtggacaagctgctcgaggagaaggagttgaCTATGAAGGTTGAT
CCGGAAGCGGAGGAATGGCTGGCTGACGCTGGATACAGTCCGCTCTACGGAGCTCGTCCTCTCAAGCGTCTCATCCAGCAGTACCTGCTCAACCCGATGG
CtgtgaagttgctggagggCTCTGCTTCTCCCGGCCAAATGTTGCACGTTGAGGCGAATCCAAAgtacgaggaagaagttctgAAAAATGCGAAGACCGC
CAAGCCGCTTCTCATTTCGGTTGAGTagaagctg