Description :
From Genome Similarity Track
Location :
Scaffold_459:6798- 7991
Sequence
1193 bases(100 bases per row)
TTTCTCAGCAAAGCCATGACACGAGCACCGCAGCCCACCCTCGGGTTCGGCGCGCGCAGTTGCATGCAGCTCAATGATACTATTGGGACCGAATGGACGA
AGATATCCAGCTGTACGACGCAACTTGCGAAACCTGTGTACGCTATAAGTCGAGTAGTGCCAAAGCCAACGGTCGAATGATCACAATCAAGTCTCCTGAC
GAATACTGGCATACAGTTTCCATCGACTGGATCACATGGCTCTCTGTTTCCAATGGCAAAGATTCAATCATATTTTGTGTCGACAAGACATCGAAATGGC
CCAAGTACTGCGCCACGACGTCGAACATTGATGCACACCAACCTGTAAAGGGTATTTTGCCATTGTTGTCCGCAACCATGGTCTGCCTGCTGTCGTTATC
AGTGATCGAGATCCAAAAACACTAGTCAGTTTGGCAAGATTTGATGACCATCATGAACTTGAAACACGACATGACTACGGCCGCGCGAGTGCAAAGAGAT
GGAGCCACAGAACGGCAAACCGAACTTTAGAAGATGCTCTACGTTGCCAAGTGTCCTACTTGGGTCACGAATGGACTGAGCATCTTGGAACCACCGACTA
TGCTCATCAAGGACTCGTACAAACATCGACGGGAATGACCCCTTGTGGAGTTGATACTAGCAGAAAGCTTCGCAATCCAGTGTTAAATGACGTATTGTTG
TTGAACGAGTACACGAAGAACTTTGCTGAGCTACGCAAGGAGTTGCTAAAGATGGCCCTGGACAACCGCGTAAAGGATCAAGCCCGCCAAAAGGAGTACT
ATGATAGTAAGAGAGCTGAAGTGAAATTTGAAGTCGGCGACAACGTCATGCAAGCTAGCTACACGCGACATTCCGTTAAAGCATGCACAGCTACTCGACA
AGCGAGAAAAGTCAAATTTCGTACCGCGATTCATTGGTCCCTTCAAACGGGAATAATCAACTCTAATGAGATGCGGTTGGCCCTACCTGCGTCAATGTGG
CGCCTGCATAACGTCTTCAACGTTGAACGCTTGAAGCGCCACGTGCCAAATACATCTCGATTCCAAATCCGTCCGATTCCAAAGGCTGCGCCCCAAATCC
TGGACCACATAGGAAACGAGCTCTTTATCGTATTAGCGCTGCTAAAGCAACGGCAATTCAATCGCAAAAAGAAATATCTTGTCCAGTAGCATG