Description :
From Genome Similarity Track
Location :
scaffold_39:6797- 8201
Transcript NameFunction/comments
Pl_111423Argonaute5 (AGO5)

Sequence
1404 bases(100 bases per row)
GGGAACTCCCTCAACAAACTTCTTGCCATTCAAGCTCCATTGACCTCCGAATGGACGCTCCGACACATTGTGGTATTGGACGTCAGGAGCTTCCATCACA
CGAGCTTCGGTCGATTCTAGACGTTGGTCCACTTTAATGCCAAACGCAGCGAGGAATGGGTCATTCTCAAAGCCGGCTTGGCGGATTTGCTCCATGATGT
TTTCCTGGCGGTTGCGTGGGGGTTGGCTGGTCTGGCGAATAATCTCGGCAGTATCCAGATCGTTGATGTTAGCACATCGCTGCCCTGGAGCAACCTCACA
CACCTCAATAGGCAGCCAATTTTCTTTGCCTGGGCGCTTACTACCGACGTTTACCAACGGCAAATTCGGGTAGCGCAGCCGCATATTGTATTTACCACTG
AAGTAATCGGCAACAGACATGGTTTCACCCTTGATTTCTACCATGGTCAGGTTGGCGGGCTGAGCACTTACTCCGAAAATCGCGCGTTTGCGGTCCTTGC
GGTGAGTCGGCACGACCTCAATCTTGCGTAATGCTCGTGCCAACGACTTCATGTCACGTTCAGTCAGGTCCCGCACATCTTCTGGCCCACGCACTCTCAG
AGCTGCGACAGCAAGCTGCATGAGAGGACCTGGCGAGTAGAACACTGTGGCTGCCTGGTCAACGTTCATTAGCAACTTGTGATCACCAGGGCGGATTGCC
TGGTGATACCCCCAGCATAACTCTTTGCCACCCTTCAGGGTGTGCGTTTTCTTCATTGTGAAAAAGTTGCGTCCGACAGCAATCAGACGTTGGGCACCCA
GATGACGCGCCACAACATCTAGTGCTTGAAGAACAGGCATAACATTTACATCTGGGTTCGAGTAAGAGTCCTTCAAACTCGACGTTGAGATCGTCTCAAC
CAGCTTCATCTTGACAAGGAAAGTTCGTGGGCCTCTGAAAACCCGACGTTGGGCACCATCACCACCTGCTGGCTGTGGAGGAGGCACAGGCGTCGCGCTG
GGGCCATCCGGATTAATGTCTGGGAAATCTTTTGCGTTCCACGACAACATCGCCGGTGAATACAGGGCAGCCATACCATCATGAACCACACGAAGTCCAC
CGAACTCTGCTTCGTACTGCCGAAGTGCAGCGTTAATCACGTTACGCACTAGTGAGCGAGGCAGAGGACGTTCTGGGCGTGCCTCTTGTTTGGGTAGAGC
AGCCGATGGCTCGGTCATCTCCACGTCCTTGACGTCCATGTTATTTCGCTTGGGTTCGTCACCCATGCTTTCATCCTTCTGGTCGGGACCTGAAGGACCA
TACTTGGAGTCTGCCTGAAGGTCAGGCGATCGCTCCACAGTCACATGATACTTGAAAATCTCTGCAGGCGCCGAGTCAAGCGAGATGGCAAAGTAGTTAA
TGTT