Description :
From Genome Similarity Track
Location :
Scaffold_145:67949- 70722
Sequence
2773 bases(100 bases per row)
TGGCAGCGATCACACGATCCGCGCAGCGAAAGCGTCAAAACCCCGAAATTCTGCAAGAAGAAATAGTGCAGCAGATGCGGATCGAGCGGATAAGGCAGGA
ACAAGAAGAAGAAAGCTGGATCGCCAACCTGAAGTAATATCTTATAGGCGACTCAACCCAGTTGAACGCGGAAGATGCAAAATTGTGCGCTCGGATCACT
CCAGACTACGAAGCCGACGAAAATGGATTGCTGTTTTTCAGCTACCGATCTATCAAAACGTGGGACGATCGCATGGAGATAGTCCGTCTGGTTGTAACAG
AATTGTTACAACATGATTTTATGCACCATTACTATACGATATTGAAAGGTGGCCACCAAGGGATCGGGAGGACATATCAGTGGATTATGTCTAATTTTCA
TCGGAGGGGTTTATATCGGAGTATCCAGCTTTATGTTAGCGAATGCGTGGACTGCACAACTGGGAAAGGTTTACCTGCGATCCGCGACAGATCCCCGGGG
AATATACAGGCTACATACCCATTTCAGATGATCGCAATGGATCATATCCCGGCTCCGGAACATTCATTTAAAAGTAACACTGAACTACTGCTGTGAGTTG
ATCTCTTCTCGGATTACGTGATCGCGAGAGCAAGTTCGTTGAGGACCGCACAAAAGATCGCTAAAGGCTACGAGGAATGTGTATTCCGAAGATTTGGAGC
TAGTGAAGCGATACTTCACGACCGGGAGCCTGGAATTATGTCTGATTGTTTTCGAGCTTTTAACGGGATCGCAGGGCAAAAGTAGCGTGCGACCATGGCT
AACCGACCGCAAGCGAACGGAACTGCGGAACGCATGGTGCAGACGTTAACTCGAGAGATCAAGATGTACGTCACGAACGGGGATCAGAAGGATTGGGATG
AATATGCGGAAAGACTGACATTCGCCATGAATACGGCACAAGATTGCGTCCGTGGAGATACCCTGTTTTATTGGATCCATGGCTGGGATCCAAGAATCGA
CGTGGAGGCAACCCTACTGTTACGAGCTCTAAAACACGCGGTGTCGACCCTCGAAGATGGCGATATAACATCGAGCGTCAATATCAAAGAGCAAGAGCGA
CGGTAAATAAAGTGTCTCAAGATCGCGATCCGAGATCGAGCGGATCAGCATAATGACCATCGTGAGTCGTGTAACATAACGTGCGGGATGCAGGTTTGAC
TCTATTTGGATCGGGTCAAAGACGGCTACGCTTGTAAGTTAGCACATATGTGGCATGGACCATTTCGAGCGGCTGAATTGTGTGGAGAGCATGCAGTCCG
TTTGGAGATTGCAGGATCTCCATACCGACTGTTTCCAGTAGTGCACGTTTCCAAACTAAAACAAGTGGTACAGTTCCCCGATCGCCCAGGCAATACGTTA
GTGGTAAACTGTGAGGATCGCGTGGATTTCGATGAGTCGCTGTTGCCGGAAGATATTTGGATAAATGAGCTGGCTATTGATGAATAAGAAGTGGAGAAAA
TTTTGGACGTGCGATTGGAACGTAAGACCCGTTATGGCCGAGTGAATAGACAGTATTTGGTGCAGTGGAAGCTACATAGCGATCCGACCTGGATAGACGA
AGCGGATCTGAACTGTGGAGCGTTGCTGCAGAATTTCGAGCGCAACCGTGTAAGTCGAAACCGGTTCAAGTTGATGCAATCTCACGAAGTGGAAGCCGAA
GGTTAACGAATACTCGAAGCGCCTGGAGGTTGAAGTATACAAGATGGTGGATGGGATATACAAGGAGGTTGTATGAGATAATGGATGGGACAATGTACAA
GGAGGTTGCACGAGATGGTGGATGAGTATATGTACAAGGAGGTTGTACGAGATGGTGGAATTGGGGTTGTAAGTGAAATGTGTGGCGATAGAGGATCACA
AGAGTCCGATCGCGGCTGAAAAGCCGAAGAGTTAAGATTAATTTCACGATGAAGAATGAGATCAAAGACCGATGGGAATTGTATTGAATTATGAAGCTAT
GAAAACCGAACCCTAGCGATCACACAGGAACGAACTTACCAGGCAAATGTGGGATCGATGACCCGGGATAGCCTGCGATCGAAGACCGATACTGGGTACG
CCAAGGTTCAGCAGCATTCAGCGGCGAGAGAGCCGAGATCAAGCTGGGAATGTTCTTGTGCTTGCATCCCAGGCCTGGATACCATGAGGGCACTTCCATT
TGGGATGGGATTGCAAGAAGAAGGAATCCAGCAGGATGTCTAGATCGCAGTGGACCGCGATCATACCCTGCAAGATGAATCGAAGGATCACCTTCCACCG
GGGCCCAACTTGCGATTGACGTTGTTTCCACTGCTTCCAGATGTGATCCTACTCGGGATCGCCGGCCCGCTGTTCGCTGGAAAGGAAGACTGCATGCGTG
AACTCCCAAAAAGCCTGTCGGTTTCGATCCTCAAAGTCCAATACAGGGTGACGAGCTGGTCAAACCACCCAGTACGAGGAAAAGAGATCGGTGCGATCCG
GCGGGCAGCAGTCTCCCAAGGTTCTTGGGCGTAGAAGGCCGCGATCTGGGCATAAGACACCAACCGAGGAGTCCACTTGGATGCGAGAAGTGGGTTCTTG
CGCACAAGTAACGTTGGAAACAAAAATCTTTTAGGACGAGAGAAGTGGCGGAACAAGAGGTAGATGTCCAATTCCGCGACACTCGTCCAACTGACTCTGC
ACGCCGACCAGGGAGAAACGTGATCAGAAGATCGCGGTACGCTATCTCTGTAACCAGGGATCCACTGTTCACG