Description :
From Genome Similarity Track
Location :
Scaffold_50:679- 2099
Sequence
1420 bases(100 bases per row)
TAGCCATGGATCATATCCCCTCGTTGCCCAAGTCGTTCAAAGGGAACACAGAATTGTTGATTTGGGTAGATCTGTTTACCGGATACGTGATAGCCAAAGC
TAGTGCGTCTAGAACCGCAAAAATCATTGCTGAATCGTACGAGGAGTGCGTTTTCCAAAGATTTGGTGCTAGGGAGATGATTAGACATGATCGGGATCCA
GGCTTTATGTCGGATTTCTTTCGAGCTTTCAACCGGATCCTGGGGCAGAGACAGCGAGCAACCATGGCATATCGTCCCCAAGCTAACGGGTCGGCCGAGC
GCATGGTGCAGACGATCACGAGGGCACTCAAGATGTATGTCTAGTATTTGGATCAGAGGGATTGGGATGAGCACGCAGAACGACTCCCCTTCGCGATGAA
TACCGCCCAAGACAGGATCCGGGGTGATACTCCATTCTACTTGGTACATGGGTGGGATCCCAAATTCACCCTCGAAGCGGCCATTCCAGTATGTAGCACC
AAGAAGAGAAACCGAGATCCAAGGCGATGGCGATACCAAGTCCAGAAATACTACCGGCAAGCCAGATCCCAAGTGAACGAACGGCTGCGGAGTGCGATAC
AGGATCGAGCGGATCGACACAACGAAGACGCCCGTCCGCATAAAATCCATTGGGATCGCAGGTGTGGCTTTATTTGGATCGAGTAAAAGAAGGGTACACC
AGCAAATTGGCCCATCTATGGCATGGACCGTTCCGGGTGAGCGAAAAGATAGGAGAACATGCGGTAAAGCTGGAAACGGCATTTACCGAATATCGCCTGT
TCCCTGTAGTACACGTATCCAAGCTGAAATTGGTCAAAGAATATCCAGATCGGCCGCAAACCCGTCTTTCGGTAGATGGATCCGACCGGGTAGACTTCGA
CGAAGTCCTCCTACTGGAAGATAGTTGGAATGTGGACCTCGAGGCCGACGAGTTCGAAGTCGAGAAGATCACCGACATGAGGCCAGGGAAGCGAACTAGA
TACGGACGGATTTGCCGTGAATTTCTGGTGTATTGGCGTGGATATGACGAACCCAGTTGGGTAGACGAGGCATATCTTAGCTGTGGAGCATTACTCTATG
ATTTCTTGCGGGATCGTACGAATCGTAACCGATTCGGCGTGATGCAGGCTCATGAAGAAGAGTAGGAAGGGGGATCCATGGATGTGAGTTGGTCATGTCG
ATGGGAGGATGAAGGAGGGGGTGTGGGCCAGGAGGAAAAGGATCGCTGATGTGAGTTGGTCACATCGGAAAGAAAGAGAAGACGAATCCACAGGGGAAGG
GTTGATTAGGAGGAAGGAGTGAATGTTTATGCATAAAGAGTGACGTTTTACGTGCGAAGAGTCCTGCTTGATCTCAAGCGCGAGCTTTCAAGAGCCCGAA
CTATACGGGACCCATTGAAA