Description :
From Genome Similarity Track
Location :
scaffold_12:678956- 681669
Sequence
2713 bases(100 bases per row)
gctgtcctggagaagACTAAGGATCCTTCGGATCTGTATTATCTTTTGACAAAGATAtctcgtctccaaagacccgccgtcggtccacCCTCCGGACCAA
GGTGAGCGTCATGAAATTATTCtaattccgggaaccaaatactgcgtaacacgctaatggcccctgcccaaagagctttgtgacgtcattgccgcctttt
ccgtgcgaagcactacgcaggaatggtgcgtgagagtaagtcttcCCCTTCGACATCCACGTTCTGTGTCTGGAAGCCGAGCGGCAAGTGGCATATCGTT
CACCCTTATAAAAAGCTAAACgccgccaccattccggcacaaacgccagtaCCTAGAAAAGattttcttcagaacaaaatGGTTGGCTATACAAAGGACA
GGgcattcgacttggtcaatggttagtaccaattgctcataaaagcgagtaatattccgctgacagcggtgagtactctgagCGGGATactttgggagtg
gctggtgatgcctcacgggctgcaccagcaacatttaatcgtcttgtgacgcagttgtttaggCCATAtttgggcgtatgcacagacatactttgacgac
atcttcgtccacagtcaagCGGGGCAAGGAAGGACAGATGTGGAcagccacatcgtccattgggagcggtgctcaagtgcatgcgcacgaataagttgta
cgctaatgcagacaagtgcatcttcggcactAAATAAATTTCCTTCTTAGGGTGTTTTATTGGGAtgcgtggcctttgagcggattccgctaaggTCCAT
GCCATTGTGGGCCagtcggttccaaagaacaaaAGCGACTTGCGccagtggcttggtctcgccaactatagcgcaaattaggCGGAAATGGCTCGGCTat
tgtctaatctccttaGAAGGaatacagaatggtgttgggtcACCGATCATCGGGAGGcatttgacagggtcaaagacagccaccaatactggtTTTGTTT
GTTTTGACCCTGGTCACCCGTTTAGTGTTGTCTGTGAGacttcgaactttgccatcgggtgTGCTCTGCTAGAaccagacgccgaggggcgagattgggt
gatcgcgttcgaatcccgccagcttaaggctgcggagaggttctacccagtccacgacaaggaattacgtGCGATgacgtatgcacttgtcacgtTCAGG
GTGTACCTGCTGGGCTCGAAGCCGCttgtgatctacatagaTCATGCGGTACTACgctctgcgactcagtcgcctcactctCGCAGCGATGGCCAGGTCG
CTCTCATTCATCGCAGGATagtaacttcgaggtgaagtataggCCAGAAAAGCCGAATTTTTTTTGGCGGATGCGTTGtcgcgcagaccagactatgatc
ttgctcatgtcacgacggtgacgtagtcagtgacggatttgatccgcgccgcatacgcgggtgatagtatgtgtgtagcgctgctacaggctctcgggag
caaggagtttggaaactcggacaagagatcgtcggcgcgtttgcgcgcacggttacaccgatattcgttgagtgacgggttgctgtattattgcaccgat
ttaacggatacaccacgaaatgtgcttcctcacgatgaagatttgaaacATCGTATTATTTATGAATCCCACGATACCCCActaagtggtcatctcggtc
gtgagaaggcGTACAACTCGGTGAATTGCCATTATTGGTGACCCatgctgtacaagtggacgagcacacatgtgcgcacgtatTATACGTGTCAGAAAGT
GAATCTCTCGCCGAATCCGGcggtgccgctggccagtgtatcagtgttggcagtccatgagtatggactttgtgtttggcctgccgaagaaatcggcagg
caacacgtgTCGTGGTTTTTTCGACCGTTTGGGCAAGATAGCTAATCTTGTggtagtgccggacaccatcgacgatgtgggtatagcgacgctgtttttc
GATCGTTTCTTTAGACAGCATGGACTtctggagtcaattgtctctgatcgaGACCCGaacttcactgggaagttttggtctacactctTTAGGGTGTTGG
GGGCCAAGCTGACTATGTTAACAGAGGACCATTCGcaaaccgatggtcagactgagtgcgtgaatcgcgtcgttgatcACGTTCTTTTCAGcgcctgcgc
tgagacgccgaagcgctggagcactatgttgccactcgtagagttgtTCTGAAAAATggagtgcattcatctaccggctatacgctGTTCTACGTGAGCG
AGAAAATTAATAATCGTGGCGTCCCGCtaacgctgccatcccatggctcagagctCGGTGGGGGAATAGCCggacggctagctgatgccagCCCCCATAC
CgcgcgtaaagaagtcggagacttcctgtctagtAAActgtgtcttacgacacgatcgcgatgcgatgactgagAGTcaggacatgcagaaggaatatgc
aaacggaaaaggaaaagaaatgttgaatacattgaggtcggagacctggttttattaaacgcTGaagaccttcctacacatgaagtatctgctgtctttg
aaaCGAAGCTCCTTCCacgatttattggacctttaaaggtcgtggccaagcgagggaTAGCGTATagtgaaccttccgagaaggatgcgcatccacccgg
tgtttaatGTAGG