Description :
From Genome Similarity Track
Location :
Scaffold_117:67884- 73173
Transcript NameFunction/comments
g15505.t1XP_008908969.1 hypothetical protein PPTG_13258 [Phytophthora parasitica INRA-310

Sequence
5289 bases(100 bases per row)
CCAGCCATACGTCCAACCTCCCAGACCACCCACGACAACACTGAGCGAGGCCGCAAATTCACTTCCGGAGCTCAAGGCACGCGAGAAGCCACCGTTGTAC
ATCATACGCGTCTGGATCGTCTTCATGAACGGGAAAGCCGACAGCAGCAAAAGCGGCACTGCCAAGAACAAACCAACGATCACATCAAAGAAGAAGGCAA
GTTCGCGAACGAGACCCCACTTAGCAACAGGCAGACCGAACAGTCCGTGTAGTAATTGCAGATAGTGCAGGAGAGAAAAGAGCCCCGTAAAAATGGCAAC
CGTCAACGAGAAGGACTTGATGCTGTCCCAGTCTTGCATAGATCCCACCACAAATGGAGCAACTCCAATAATTATCACCATCAGCACGTACAGTACTGCA
CGCGGAACACGAGCCGAGTTGCGCAAGCACATACCCAAACCAAAACCGCCGATCCATAGCACAACGGAAATGCCACCAACGCAAGCCAACAGCATCCCGA
TGTCGCTCAGGCTGAACGAGAAGATGAACACATAATACATGACCAGCGGGTGGCGTAAGTCACGAACTGCGTAGACAAAGCGGCTCATCGGACCAATCGG
GTACATGAGGCTGGCCTCATAGTTGTAGAAATCGTTCCACGTGTCTTTCGGGCCTGCAGGACTGCTGCTCATGTGGTCCGGAAGAAGCCTTTCATCGCCG
TCTGCCTCTTTGACAGACATGAGCCACGAGAGCCAGTAGGAGACATCCACCATGGTCTTGGAGAAGTCCAAACCGTCCGTGTTGAACAGGAATGGCGCAA
GCAGCCAACATGCGCCGAGCAACCATACCGCAAACGAGGCAATGCCATAATCTTGACCCTTAGAGCTGTACGAATTCAGCAGCGTGATGTTCGACGGAAT
CTGGTCTGGGTTGGTGTCGCAGTCAAAGTCCGCAGTAGCACAATACTCGGCCAGTATGTTCGTACCGATGCTGAAGTTACCGTACGTACCAAAGATAAGC
ATTAAGCCCATAAGCTCCACAGCCTTGCGATAGTGAGAAGCGGCGTATTCCTTGTAGAAGTTCACCATCGTTTCACGAACGATGGCGAAGCCACGACCGG
TACCTCGGTACTTGGAGCCACCACGCATAATAGCAACGTCGTAGAAGTGCGACTTCGTACCAGTCTCGAAAATGTAGAACACTGGGCCAAGAGTCACAAT
CAGCTCCACGAAGTTAACCACGGCTTGGTGCCAACCGTACTCCACGAAAAGTGTAGCGATCAGCGGGATAGTCATCAGCATACCGAACTGGAAGATAAAC
TGCGTGTTCATCACCTCTGCCAGGTCGTCCAGGTAGCTCGTTGTGATGATGGCTGATTCCTGGATTTCCTGGTGAAGCACGATGTAAACCTTGCCGTACG
CGTACGCAAACACACAGAGTACCACCAAAGCGTTACAGATGTAGAAGCCCATGTGGCCGTAGAACATCGAGTTCAAGCGGAAGAAATCCATGCCAGCACC
CATCCGGTGCGACTCGCGACTTAGGGAGCTTTCAGCACTACCGTTCGACAGCTTAGCCTCGAAAGCGTTAATTTGACTCAGCGTCACATCACGGCCCTTA
CCGCACTGCATGAACTCTTGGTGAGTAACGTGTTCGCCGCGAAGGGCTGCATTGTATCCAGCGAACACATCTTCGGACAAATTGATACCCTTGCTTGCCT
TCGATACACCGCCATTGGACATCACAAATGCCTTCTCGAACACATCGGGGTGACCGTAGTGCATACGACTCTGCAGGGGATTCGCCAGCACACGCTGCGT
CAAACTCACGAACACCAACTCCTGCAACGTCATAAAGTGTGCCAAAGATGATGCTCGGCCCGTGAAAATGTGCTCTTTCATGCCAATAATGGTGACATTC
TTTCCGTTTTCCGTAGCCGTCGCCAGGAAATTGGGGATCTTGAGCGCTTCTTCGAAGTAGTGCTCCTGGTTCATATCAATCGTCTGCAAGTACTCACCGC
GTGTGAAAGGCAGGGCAATGTTCTGGTTCTCCGGCTTACCCTCGCCAACTAGCGGGTTGCCAGGAAGCTCATAACGGTACACCTCAACAATTTCATCACC
ATCCGACTTGACCAGTACGCAGTCAAAACGAGGCTCCGTGCCGCTGCCTGCGGGTGGGCGGATCGTATCCACGTAGCTCACACGCCAGTTCGGGTACTTG
CGCATCAGAAGGTCAATATCTGCCGCGCGTGAATCTCCAGCTGCAAGTTGATCGGCGTAGATCTGGCAACTGGTCACGTACGAGAACTTAAGACCCGCAA
TGCGATCCATGTGCTTGATTTTTTCCAAGTGAGAGATTTTCTCGTCCGAGCCAATCTCGAGCCAGCGCAACATCTTGAGTGCATCTTCATACATCATCAT
ACCATGCACTGTACGTGCCAAGGTCTGTCCACGCATTGAAGCCCAGAGGCGAACCTGCGTCGGTGTCTCTGCAAGCGCCTCGTCCATAGAAGCCACGCCC
ACACGCTCAAGGAAGTTACCCCATTCGTCATCGTGGAAGGTGATCAAGTATTTCAAAATACTGAGATCACGGCCCTTTTGCTCCACCTTGCGGAAAAGCG
GGTTCGAGTCAACACGTCCGTTCAACTCATCCACCGAAAACAACACCGTTTCGTTGTAGTACGGCGTAACTACAGAGAAAGACTTCATCGCTGCAATCGA
ATCAATCGTCGGAATCTTCATGTGAAGAGAGTTCAAGAAGAAACTCATACGACGTTGTGCTTCGTGGCAACGAGGCAATGCATCGGCAGCGTCCAAAGTC
AACAAAAAGAAGAGTCGCGTGGAAAGCGACACCACACTCTCATTCGAACTTGGCGACGTCGTGCGGGTGGGAGAGTTCGAGTCACGCTGACTAATGCGAT
CAGCAAAGATCGACAACAACTGTTCCTTTTGGTAAGCAAGGTCCGGCGTCATCTTGGCAAACGCAGACTTCCGCAGTTTTTCTGCCATCCATTCCTCTTC
CAGCATAAGCTCAATGCTTTTCAGTAGAGCGTCCAAGCGTTGCACGACTATAAGAACCTGGTCGTGCGGGAAGCCAAAGGCGCCACCAGCAGGAACGACA
CCTGGCTCCGGCAAGTCCAAAATGCTCGCAAGCAAGTCAGTCACGTTCTCGCGCACCAATCCAATGTGCGTGAGGTTAACTACGCCGCTCACCCTGCCTC
CAGCTAGGATTTGATGGAAGACGCCAACCAGCTCCGAATCTTCAGGGCCCAGTAGCTGACGTAAAATTTGGAACAGAATATCAACACAGTTGTTGGCGCA
GCCCAGTAAGCCTGCCTTCTTCAACTCCTTGAATAGCTGTCCGTCACTCATGCGCTTGGTTTTAGCCTTGGCGGCAATGTCAGCGGCTGCTTGTGCCTCG
CCAGCAATCAAGAACACGGGCTCTTCGACGGCTCCAGTGTCTGAGATCTGGTACTGAAGGATGGCTGTTTCACGATCATCCAACAAGTCAGACAAACGGA
AACTGCTCACAATCTCATTCCACACAACAGCGAAGCGGAGGCGGCTGTTGGCATCAGGGGCAACAGAACTCGATGACAGCGGGTTGTTGTTGATAGCGAG
TTGACCGCGGGCTGCAGCAGACACCACCTTCTCGTCAAAAAGACTAGGCGCTTGCTGAAGGCGCTTCACGAACTCTGTAATGCGTGCCGAGTGGCCAATC
TTGAGACGGAAACCAATCCAGGCACCCACAATGGCCTGCGCGATAGCTAGCCAAATCTGAGAGTCGTAGATGTACACGAGGAACACCGGCGCCCACATGG
CGACGAGGAACGCAATGTTGTGCTGCGACTCGATGATACCGTTCTCTAGCTGAGCGGCGGAAACATCCACGCCGTAGATTTCGACGCTGGGTCCGATAAG
CGGCTTAACCATCAGCTGTAAGTTGAACAAGAACTTGCACAAGAAAATGATCGTCCAAAACGTTCCGTACGACAAGAAATTCCCCCAACTCTGGCCCATC
GTGCGACCAATGTACTGTTGACGTGTCCCATCCAGCGAGCTCAGGAGAGCCGATCTCCAAATAACACCGTGGAAGCACATCTGCACAATGGACACGATCA
CGATCGGCGCCATGTAGACACCGATGAAAACGGGTGCCATCGACAGCAAGTCGCTCGAGCCAACTTCTTTGTATGGCGCCGCGTTCACAGCCGTGAAGAG
GCCGAAGAACACAGTGTGCCACACGAGACGGATGAACACCGACACCGCGTACATAATGCGGCTGAAGACACGTGTGCCATCGATCCAAATGTCCAGCACC
ACCTTAACAGCGAGCAACCCGCTGACCGTCATGAAGATGGAGTAGAAGGAGTGATTGCGAATGTCCGTGATGTCGGACGTGAAAAAGTTGGCGTAGAAAT
GGATCCCCGACGTGTCGTCCGGGTCCGAGCGATAAGCCACGTAGGCAATGACGACCAGCACGTGCAGCATGACGAGCAGGAAGAAGTAGATGCGGAAGAA
CGCCAGGATGGGGTTACAGAAGCTACGTCGCTCTTTGAACGACTTGTAGTCCTGCGCGTTCACGGCTCCAGCCACATTGGCCTCGTCAAAGTGCAAGCAC
GTTTCCGTCCAGAAGAACTCGTTCACGTCGTCGTAGTTGGTCACGTTCTTGTGGTCGACGCCCGCGCCGTTTTTCTGCGGAGTGACGTTGCGCATTTTGG
CCACCACCGAGTACAGCGGGCGCACCACGCGGCGCAAGAACGTGCCGTCGGGCGCGTTGGGCAGCTTCTCCAGGCCATCCAGCTTGGCCGCCATCTTGTG
GTACAGGAAGCACAGGCACTCGGGCATGAAGCGCAGATTGCCGCTCTCCCCCCAGATCAGCAGGAAGAGCGCGATCTGGCGCTCCGCCGCCCCGGGGTAC
GGCGCCGTGTCGAGCAGGAGCGGCTGCGTGCGCAGGAACTGGCACCACTTGACGTAGTTCTTGAAGAACTTGGCGTGGATGGTCTGGATGGCACTCTCCG
TGTCCACAGGCGTCACGGCCGCCTCGATGATACGGGACTCGTAGTTGAGCACCCAGCACTCCAAGTGCTCCTTTTGGTTGCGCACGTTGCCTTCCTGGAA
GCCAAATTTGGCCTGCAGCAGCTCGAACGAGTCGGCGCCGGGGCGCGGCGGGCGCATGGGGCCCGACGCCGTCAACGCGGCGATGGGCTGCTGCGGCTGG
AACTTGTCCATGGGCGGGCGGCTGATGCTCACGCCGCGCTCGGCTGCCACGTCCTCCACGGTCTGGTAGTTGGAGGGCGCGCGTCGACG