Description :
From Genome Similarity Track
Location :
scaffold_10:6786- 8235
Sequence
1449 bases(100 bases per row)
ACGTTTTCAATGCTCTAACGTTACTATTAAAGAAGTGTGTAAAAAGTACAGAGAGGCAAGTCTTTGACACACGCGAGTCGGTGCATTCAATTCGCCATAT
GTATAAACACGGATTCCCAAGTTTTCAGCTACTCCTGACGATGGTAGTTTTTCTATCTCCTGATTGGCTAGGAAGCTGTGCTGTCGAGGTTTATGCACTA
ACCCTGAATGACTTGGATTTCTATGCATGACTTCGAGTTTGTATGGCCCCCGAACATGATAAATTGACCGAAAATGGTCGCGGAGTTTTCATATAGGAAA
CCCGAGCCAAAAATGGGAGGACACTCACCTCGGAGAAGACCCGGAGCGTTCATATAGGAAAGCCGAGCCAATAAATGGAGGACACGGAGCACCGGCCTAC
CCTTCTCCGGTTTGTCTTGATTTCACTATACTGTCCTCTCGTGTATAGGGACCCTCTACCCCATACAAACGCCTTGTCGAGTAGTCATCGCACGATAGTA
ATACCATGGAACGGAGCACATTCTGAAACGTAGAGTCCCCATGTTTCAGAGCTCTAACGTTGATATTGAGGAAGTTGTAAGAAAGTCCATAACGGCTCGT
CCGTTGAGAAATAGTAGTACCATTGAACTCCGCACATGTTGAAACGTAGAATCCTACGTTTTCAATGCTCTAACGTTACTATTAAAGAAGTGTGTAAAAA
GTACAGAGAGGCAAGTCTTTGACACACGCGAGTCGGTGCATTCAATTCGCCATATGTATAAACACGGATTCCCAAGTTTTCAGCTACTCCTGACGATGGT
AGTTTTTCTATCTCCTGATTGGCTAGGAAGCTGTGCTGTCGAGGTTTATGCACTAACCCTGAATGACTTGGATTTCTATGCATGACTTCGAGTTTGTATG
GCCCCCGAACATGATAAATTGACCGAAAATGGTCGCGGAGTTTTCATATAGGAAACCCGAGCCAAAAATGGGAGGACACTCACCTCGGAGAAGACCCGGA
GCGTTCATATAGGAAAGCCGAGCCAATAAATGGAGGACACGGAGCACCGGCCTACCCTTCTCCGGTTTGTCTTGATTTCACTATACTGTCCTCTCGTGTA
TAGGGACCCTCTACCCCATACAAACGCCTTGTCGAGTAGTCATCGCACGATAGTAATACCATGGAACGGAGCACATTCTGAAACGTAGAGTCCCCATGTT
TCAGAGCTCTAACGTTGATATTGAGGAAGTTGTAAGAAAGTCCATAACGGCTCGTCCGTTGAGAAATAGTAGTACCATTGAACTCCGCACATGTTGAAAC
GTAGAATCCTACGTTTTCAATGCTCTAACGTTACTATTAAAGAAGTGTGTAAAAAGTACAGAGAGGCAAGTCTTTGACACACGCGAGTCGGTGCATTCAA
TTCGCCATATGTATAAACACGGATTCCCAAGTTTTCAGCTACTCCTGAC