Description :
From Genome Similarity Track
Location :
contig_2:67859- 71740
Transcript NameFunction/comments
g495.t1RAW25626.1 hypothetical protein PC110_g17963 [Phytophthora cactorum
g496.t1RAW25623.1 hypothetical protein PC110_g17960 [Phytophthora cactorum

Sequence
3881 bases(100 bases per row)
GAGTCCGGCTCGAGCTACGAAGAGAGCGAGGCGCCCAAGGACATGCAGAAGCTGCTTTGGTTTGGCACCGTGCAGGGCACGCTCGACGATATTATGTACG
GGGTGGTAAACCCCACCGCCGAGGAGGCCAAGGTCAAGGCTGCCTACGTGGGCAGCAACGTCCTGGACTTTGCCGTGCTCGACACGATCATCTACCCAAC
GGTGGACGAGCCTTTTCGAAGTCTGCAGATAAAGTGGGCGGTGAACGGAGGCCCGTCCATGATGCGCGCCATGGTGCGTTGCAGAGACTTTGTCTACCTT
GAGTCCACGGGCATGACGACGAGCTCGACGGGCGAGCGCATCGGGTACCACATCTTGCACTCGGTTTCCGTTCCTGGGGTGCCGAAGCTTCATGAACACA
AGATCATCCGAGGCAACATGACCCTCTACCATTTGTATCGCCAGAAGAGCGACGGCGTCGTCGAGACGTACGTCAAGGCGTTCGTCGACGTGATGGGGGG
CATGCCCTCCAGCATTGCTACGATGGTGTCCGCCAAAGGGATCGTGTCGGTGTGGAAGCTTGGAGACTACGCCGAGATGAAGAAGCTCGTGTGGCTGCTC
AAGCAGCACAAAGCGATGCAGTTGCACCAGGACAGCAGGTCCAGCTTCTGTCGTGTGTGCCACAAGGACGTCAGCGGCGTGCTATCACGCCGACAGGCCT
GCTGCATTTGCTCGGGGTGCGTCTGCTCCCGGTGCAGCGTTCCCAAAAAGCTGCATCACATGTCGCCGCTCACTTGCACAGTGGTGCAGACGTCCGTGGT
GGTCTGCACGCCTTGCATGCGGACAGTGCTGTCGACCACTTGTCTAGATGCGGCACAGGCCGAGGTGGGCCGGGACAGTCGGCACCGCGGCGAGCTACAC
GACGGCAGCTCCATCAAGGACACATCGTCGCCATCGTCGTCGGCGAGCTCGCACGCATGGTAAGGAATCAAGTGTACAGTTGTCGATAACCTCGAAACAG
GTCGTGGACGTATTGAATAGGTGGTAAGATGGCCGTCGGTAGCTGTCGTAAATGAAAGTTGTAGAGCATAAATTCAATCGAGCACAACCAATGGATACGA
GGCGAGAGACGGAGGGCCTGCAGGGATCTGCTGCGGCCCTGTGCGTGCGTCAGCGTGGTATTCCTGACGTATTCGGGGCCGATTGCTTCGAGGTGGCAGT
CACAGCTCGACTGCTGAGTCAGCAGTGCTGACCGCGGCTTTGTATTCTATTCAAATGCAAGGCCGAGCGCTTGCATAGCAATGAGCAACGACCACCTCGT
CAACACGCGTGTTGCTCTCTTCGCATGCAGACCCACGATTGATGCCCCCCTCGTTGAAACAGTTTCCGTTGTCCTCGCCACCGTTTGCATTCTCAGTATG
CACTCAACGTTGTCCATTTCGTTGTCCGATATCGGGGGCTTGAAGTGCAGCCACGAGGTATTCAGGAAATCTAAGCAAGCTGCTCGTGGATAGCTAGCAT
ATTGTATTGAGCGTGGAGTTTAAGACCCCTTATGTTGTTGATCAAAGTGTCCATGTCACGGTGGTGACGGCTAGAGAAAACTCGGTACTGCATCGTCCTC
TTACTGTTGGAATCGCCGCACGATCGACTTCATCTCTAGGTGGCTACATTAAAATGGACACTTTGCCATAATAATTGTTGCTAGTGCCCCTGATCGCTAC
GCGCTTGGAGTCGGCAACTGCCATGAGCTTCAGCTGGCGAGGTGTCATTGGCCTCACGCTAGCGAAATCCTAGAAAACTACCGTACATAGGCAACTGTAA
AACAGAGAATCGCTGAGTCGAACTTGTATTGTCAAGGCTGTCGTCTCCCTATAGAACTTACCCCCTACCACTCGCCTGAGATGACACTATTTTCGCTGCC
AGGCTCTTGTAGTGTGCAGCAGAGAGCTCGAAACCGCCATCCACCCCGCCAATTGTCGACCTGAGCTGCCAGACGGTGCGCTCGTTCCTTGAGTGCTTCG
ACCTGCCTTCTTATCACCGATCAGGACGAGAGACCCCAGCCGGTTCTAGTCTCTTATGAGGTATCAGTCCACCCAATCACCTGACGAATGCTTCGGACAG
AGAGGACCGACAGCCGAGCCCTGGTATCCAGACACTTCGCGTTTTACCTGCCTCACCTCAAGTTGGAATGAAGTTCCCGTTGTCAGCGTGCCCGTTTCAG
TCCTTGGAGCTCATTGAGAGCGAGAAGGACACCATCAAGTCGATCTCCGATGAAATCCTGACCGAAACCATGGCGGAGTACGAGCGGATGCTCGTTCATG
GCCACGGCGTCCTGGATACGGAACGCTGGAAACTGATCAAGCGCAAGGAAAACCTCGCAGCCTACCAGGATCGATGCGCCCTCGCTGTTACCCTCCAAAC
ATCTAGCAGCACCACCAAACCGACGGTCGAAATCGCCGACGACCCGGTCGCGCCTCCCCCAGCACCGATGTCTGGTGCGCCAGGCAAGACCCCGCTACAG
AGAGTGCTGTGGCACGGCACGATCAACTGCGACCTCGACGACCTCATGCTTGGCGTCGTCAATCAGAACGCCGACATGTGGAAGGTCAAGTCCTCCTACG
TCGAGGACAATGGCCTGGATTACTTCCTGCTCGCATCGATCAACGAACGATCAGTTGAGAAACCGTTCGACGGCCTCCAAGTGAAATGGACTGTCAACGA
TATGGGTCCAGTGGTAGCAAAGCCTATCATGCGCCCTCGCGATTTCGTGTATATGGAGAGCACAGGCATCACTCTGTCCCCCACAACCGGCGAGCGAATG
GGCTACCACATTTGCCACTCTCTTGAACTCCCTGGCGTTCCTGAGCTGCCCGAGTTCAAGTTGGTGCGGGGCAAACTGGAGCTGTACCACATCTTCCGTC
AAAAGAGCAAGGGCGTCGTGGAAGTTTACGTTCGAGCGCTTTGCGATCTGCAGGGCGAGATGCCGTCCACCAGCGTGAGTCTGTTTTCGGCCGAGGCGAT
GTCGTCGCTTGCCCTCGCGGCATTTTGTGCAGAGCGTCACAAGGTCATGTGGTTGTTGCACACGATGGAGCCGTGCGAGAGTGGCAAACCATCTCTCGAC
CTCTGCAGTGTGTGTACGAAGGATCTGAGCAAGAGTCTGCTGCCGTTCATGAACAAGGCCTGCCGAATTTGCTCGGGTCGCATTTGTGCTCGCTGCCGGA
TCCCAAAGCGGCTGAGCTTCCTCAATCGGCGCACGCGCGGCGTCATGAAGAAGAACATCGACATCTGCACTCGCTGCGTGCACACGTCCGCACACATGAG
CGCTGTTACAGTTGCGCAGGGTGAGTTGGCGCTCGAGAACCCGACATCAATCTTCTATGAATCTGCGGTCAACCGAAGCGTGTCCTCCATCTCCTCAGTG
TCTTCTGGCTAATACTCCTGACTCTCCATTGAAGAACCATTCGCGAGCAGGTCGAAGTGTGGGCAACATCGATAAATATGCTCTCGCGGAACGAGGTCGT
GCAATGTAAATTCGTATGTGCACAATGCATCTATCAAATATCCGTTTGCTTCACTGCTTATACCTTCGTTGCGTTGGAAACGGGGTTCGCCACTGGAAGC
CGTGCCTAATTTGCCCTGCTGTTCACTTCATAATAGTGGCGAATCGTTTCCACCTTCTCAAGTTCACCCAGTCGACACGCTGTATTCTGGTTGTAGCTCC
AGAACAGATGAAAGCCGCCACATATCTCGAAACAGCCTTCGCTCATCTACTACAGACATCTAGGTGCGCCGCAGTTCAAGTCTCGGTTGCTCTCCTCTAC
CACTCGGAGACAATCTCGGTGGAAGACAGACGGTGGAGGAGGGAGGCGATTATTAGGAGGCGCTCCACAAAATGGAGACAG