Description :
From Genome Similarity Track
Location :
Scaffold_1151:6785- 8230
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_1151-fgenesh-gene-0.2HECT ubiquitin ligase

Sequence
1445 bases(100 bases per row)
TGTCCAGGATGCCGAAGAAGTTGGACTTGAACTCCTTCTGGTGCACGTATATGGGCAACTCCATCTGGTTGAAGCACGGCTGCGCGCGAATGGCGCGCGA
GATCACGAGCTCCTTGCCAACGATCGTGAACGGCGACAAGCGGCCGTTGTAGTTTGTCAGCGCTGCAAACCCACCGATTGGCACGCGCGTGTTGCCAGTC
GTGAAGTGCAGCAGGCGGCGCTTGTACTCGAGCGGCATCTCGCGCACGAACTTCCAGAACCACTTCTTGCTCGGATGGCCGTGGATCGTCTCGTTGTACT
TGGAGTGGAGCTCCCACTCGACCGCGTCGATCACGTCCGAGCCACAGAGCACGTAATCGAACTCTTCGGGATCAAAGAACATCAACAGTTCTTGCGGCAC
GACCTCGTAGATGCCCTTGAGGAACGCGTACAACTGACTCTGGACGCTCTCGAACAACACATACTTGAAGCGACGCTCCAGGTACTCCAGCTTGTTTGCG
TCCGTCACAGGGATGTTGCGGCCGTTCGGGATCAGGTCCACCACCACCACCTCGCCATTCACCTTCTCGGTCACGCTAAAGTCTAAGCTCAACGACTCGG
CGCCGTTGTTCTTCACTAGCCAGTCCAGGTTCTTGTACTCCTCTGGGTCAAAGAACTCCAAGTCTGTGAAGCTCACTGGCAGTCCCAGGATGATCTTCAA
TAGAGGGGTCGCGAGATGGAAACCCCACATATTGCCCATCAGCAAGCCGCGACCGAGCAGCCGCCCCGCTGAGTAGTAGAATGTCAGGTGGTCTTCACTG
ACTGCGACTCGCGAGTGGCGGTTGAAGTAGAACGTCTGCTCCGCCTTGTCCACGGGCGTGAACAGACCCGTGTTCGAGTTCCCGAGCAGCTCGTTCAGCT
GGATGAACCACTCACGCTGCAGGTTGCTCGTCGCGGCGCTGGGCTCCTTGGTGTACTTGATCGTCAGGTCGGCGCGCGCGTACCTGGTGTCCATGCAGCT
CAGGTGCTCGAACGACTGCTCGAGCGCGAAGTTGCGCGTGATGTTGAGTTTCACGAGCTGCCGCCTCGTAGGTGCGAGTGTCGCCGCGCTCTTCGCGACA
AATACAGCGTACTTGGACGGGAAATCAAGACGCGACTCGTCCAGAACGTCGCGCTCATGAGTCTCCGAGTCAAGTCGCTCGCCGAACGGGGAATGTGACG
CGTCGGCCTTGGTAGACTCGGTCAGCTCCAGTTGCGCGCTCTCGACTTCTTTGATGAGTGCCGCGGTCTTGCCCTCCTTGTTCTTATTGGTGACTGGAAT
CTGGCCGTCTTTGTTGACACTAAAGCTCACCACAAAGCCAGGGAACTTGGCGTCGGAGGCGTTGTTGCTGCTCTGGCTATTGTCTCGGTACCAGAACGAG
TTTCCCTCGATGTCGATCTTACGCACCCACTCCTTGCGCTTGCTG