Description :
From Genome Similarity Track
Location :
Scaffold_39:67848- 69249
Transcript NameFunction/comments
Sapdi_VS20SDRG_11087hypothetical protein

Sequence
1401 bases(100 bases per row)
GCGACGCATCGCGATGGTGCTGTTTCTTTGCTTGCGCCTCGGCTTCGGCTTTGGCGCGAAGCCAAATGATATAGTCTTGTTTGACCTACGCAGCGTTGAA
GCGTGGGTTTTGCGCGGAATCGAGGTACGGCCTCTCGCCACTCGAGCTCGGCTTGCCGCGCGCGCTGCTCAGCGAGCTCGGCCTCGGCCAGCGCCGTCAT
TTTCGGGCTCTTGCACGACGAGAGCTTGGGCAGCAGCGTCCGCTCGCTCGGTTTTGGGAAGAGCGAAAACGTTGCTTTTTGCGAGCGCAGAAAAGACTCG
TCGTTGAAGCCGCCCTAGCCCACGAATTGCTATGCGTTTGGCCCGAAAACAAAGCAGCAATGTACGCGCATGGACGTCGACTTGAGTCGGTTGGCCGATA
CAAACAGCATGCGCTGGGTCTAGTAAACTGTGAGGAATATCGAGGTATCGAAGCGCCGACCATTTCGATATCGCTCGTCGGATGTATGTCGAGGTTGGGC
AGCTCTTTCTAATCGTACATTGCACAATGAGAGCAGAAACACGGAGCGTACTTGACGGCGTTTGGCCAGCGACGGCCTGTGCTTGGCCTCACGGTCGTGC
TCGTCGTCCATCTCGCGCGGTGTAATGACATGCTCGTCGATGAGAGTGCCAATCTCATGCATGAGAAGACTGTGGTCGGGCGTGTTGCCGACTTGGTGGA
GAACCAAGTGCGTAACCTGCGCGACGACATGTGAGCGACGCCTCGGATGCAATAAGACGGCGGTACTTCTTCCATCTCGCGGTGGCTCAGCGAGCGCGGC
AGCTTGAGGAAGCGGCTGAGCTGCCGCTTGAAGAGCGCCGACGCGTGCGCGTCATCGTCCATGATGGAAAACTCGTCGCTCTCGTCGTCGTGCGCAGTGT
CGTCGTCGTCGTGCTGCTTTCGCTGCAGCCGCTCGGCAATCTCTTTTGTCGTTGCAAGGATCGCATCGATGCGCTCTTCGAACGACTCGTCGCGCTTGGC
TTTGGCGGTTGCTTTGGCCGCGTCCCGGTGAATCTTGGCTATAGGAGATAGTCGTACGGGTCCAAGTGGAGCTGCAGTGTACAGATAGAGATCTCGTTCA
TTTGCTCGAGCGCTGTCTGGACGCGCTCGTGCCGGAGGTCATCGAACGGCATCGAGACGGACCGCGACCGTTCCACAAGATCGAAATCGGCGCTTCTGAT
TGGCGCCAGGGTTCGACAGAGCGCAGTTCCAAGCCCAACACCAAGGGTGAGTTCTTATTGGCTCTTGTTTCCACCCAGGCGTGCGCTCGGATTGGCCAAA
AAGAATGGCGTGTGATTGGCTCGTTCGCGTTGCAATAACAGATGCCATTGGCCCGCGGTGATGCAATTTCGGCTTTGCGTCATGGCGGCGTCGCACGGGC
T