Description :
From Genome Similarity Track
Location :
Scaffold_2:678478- 679918
Sequence
1440 bases(100 bases per row)
CGCCACGATGTCGGTCTTATTGCTGTTGTAGCGACTGTCAACGCCGCAATCAGCTTGACTGCCCAAGCCACCGTGAGCCCCGAGCCCACCTGGACTATCG
ACTCTGGATGCACGCGTCATGTTACGCATGAATCCCAGTGGTTCTCGACCATAACTGCGAGCAGCGGCTCTATTACTGTTGGTAGGAAGAACCAAATCCC
CATCGAAGGAATTGGACAAGTCAAGCTGGAAGTCATTGACTCCAAAGGCACCAAGAGGATGCTCACCCTCCATGATGTGCTGTATGCTCCTGAGCTGAAA
TTCAGCCTTCTCTCGGTACCGGCAGCCGTGAAGCATGACTTTCGTTTCAGCTTTGATTGCAAGCAATGCGCCGTGCAAACCGATGCGAAGTTCAAGATCA
AGGCAATGATGGCAAACCATGCCGATCTATACCAATTCCAAGCCAACCCTGTGATGAAACACGAGGCTCTTATTGCCACCTCAGGTAAGCAGCGTTCCAA
TCTGCTGTTACACAAAAGGCTCGGCCATCCTAACGCTCGCATTTTGCATGATTTATCTAGGAGCCAAGCCATTAGTGGTCTAGACAATGATTCATCTGTC
GACCCGCAAGCACAGTTCTTCTGCACTGCATGCACATTAGCGAAGTCTCACCGCTCTCCGTTTAACTCTAATAGAATTGTTGAACGTGCCAAACACCCTT
TGGAAAAAGTGCATACAGATATTTGTGGTCCCATACCTGTTCCCAGTCTTACTGGACGCCGCTATTTTCTCATCTTTATTGATGATTTCTCTCGGTACAT
GTTCACGTATCCGATAACGAACCGAAGCGAAGTATATGAGTGCTATGAGGACTTCAGGAAGAAAGCCCTGAACATCTTTAGGAGCGACGTCAATGTCCTT
GAATATCAGCATCCTACTGAGAACTGTGACATTCAGGTTTTGCAAGCAGACAATGCAAAGGAGTATGAAAAACTCGGGCGCCAGATTTTCCAGAAATACG
GAGCACATGCGCAGTTTACGAATGCATACACTCCTCAACAGAACGGTGTTTCCGAACGACGCAATCGAACCATTATGGAGCGCGTTCGAGCCCTACTGCT
TGATGGCAATCTTCCCAAGCAATTGTGGGCGGAGTGTGTCTGTCATGTGACCACTCTGATTAACATGACACCCAGCTCGACGATAAGCAGCCGTACACCA
TATGAACTTTGGTACAATCGCAAACCATCCATGGACTACATCAAAGAGTTCGGATGCAGTGCCTATGCGCATATCACAGAGCAATACCGTGATAAACTTG
ATGCGCGAGCACGTTTGTGCATGTACGTTGGCCTTCCCGAGCACAAGAACGGCTACCGCCTAATGGACGTCAATACCCATGAAATTGTCTACAGCCGTGA
TGTAACCTTCAAAGAGGACGAATTCCCTCGTTTGGCAAAC