Description :
From Genome Similarity Track
Location :
Scaffold_1137:6784- 8151
Sequence
1367 bases(100 bases per row)
CAGAGCCAGCCCGTGGATAGTGCTTCACAGCGGAGAAAGTTATTTGTCACCAAGTCACCACGGACAAGCCACCCTTTCCCGTCATCAAGAGAGAACAACC
GAGCGACCCAGCGATGGAGAAAGTCAACTGCCAAGAATGACAGCCACCAACGCGAGAACGACCCACGGAACAGAATCGGGGAGAGTGCGTGTCGGCGATC
GGCAGGTAACAATGTGACGTCGAGGTCGAGCGAGCCCGTGGAAAGAGACACCCTCTCATGGATGGAATCGCTCGGTGTGGTCTGTCACAATATTGGAGAC
AAGCACGCTGTAGTCGATGACGTCGTGTTGTGCCAGCTGGCCGCAGCCATTGCACGGCGGCGTGGCAGCGTCGCCGAGCGCCACAAGCTCCACACGATCC
CGACGCCACAGCAGCCTCGCGGGGTCTGGCTCCCACGAGGCGTGGCACTGCAGCCGCGGACAAAATCAGAGAGGCGCCATAACCTTAGCATCGCGTGGGG
ACTGCTGAAAGAGTGTCGAGCACTCCCCGTGTCGGCCGAGGATCTCACGCCCGAGGCGCTAGTGGATCTGGTGGAGGGAAATGCAGGAGACCGATCCATT
TGGTCAATCCTTGCTGAAGTGCAGAAGCAGACACAGCACCCGGTGCCGACCAAGAAAGTGACGAGGAGCTCATTTACGTTCGTCGGAGATGACACCACGG
TGCGGAGGCCTCCGTACATCACGACCGAGCAGATTGACGTCGTGAAGCGCTGGATGAAGTCGGTCGGCGTTGACCCGTCGGAGGTGAGTGGGACACAATG
TTACTAGTATTGTACGAAGAACCGGATGATCTAACGATCGTGGCTGCAGGTGTCCTCCGGCATCCTTGAAGACTGTCTTCGCAACGGCGTGGCCTTGTGG
TATGTTGAACGCCTCCATTATCTCCATAGCTGAAGCATTGTGCATCTTACACTCAACTCTGATAGCCAGCTACTGTGTCAAAGAAACAAGCGATCCAATC
TGCCCTGTCTGGTCTATAGAGACCCGCCAAAGACACTGCTGGAAGTGCGGTAGGTTATCAAGACCCTGATGACCCACAGGAATACTTATGAGAACCCTTT
GTCATGACTACAGAGCCAACATTCACGCGGCGATCAGCACGATGGCGAGTCTGGGCGAGCCGAGCATCCCCGCAGTCTACCTCACCAAGCAGGCCCTCGA
CGGAATCACCATCGGCGACAAGCAATTCATCTATGGCGTGCTGCGACACGTGATGCAGGTGTGCGTAGCAGACGATGCACGCGCTTGCCAGTCCCCAGTC
GCCCCAACTGTATCACCTCCACCACGCCCTCCAACAGAACAACGGCCGGTCAAGAGCAAACGCACTC