Description :
From Genome Similarity Track
Location :
Scaffold_613:6784- 7867
Transcript NameFunction/comments
Phyke_g10449hypothetical protein PHYSODRAFT_511733

Sequence
1083 bases(100 bases per row)
ccttcttcaccttgcCCGTGTCTAGTGTCTCGTCCCAGTAGTCCTGGCGTCCGGCATTGCGGTGTTTCCATTCCTCCTGCTTTAGAGTGTTCAGCACACG
ATCGTGCTTTGCAGCAAGTACACGGTCTACAGGCTCGTGAGTCGCATCGCTGCCACTGGTTGTCTCTGTGGACTCCACGTCTGTTTCGCCGGCCCATTTG
TCAACTTCCCGCCCAAACAAAGCAGCGTTGCGCACACCGACGTTCTTGAGATGCCGCGGATCGAACGGCACTCGCGTCATTTTAGATGTTGGCACAGTGA
CGGCAGCGGGAATTGCCTTAGCTTCTGCATCGGCTGTTTCCACAGGAAATTCCTCCACTGATTGAGTCATTGTAAGACTCGGACAAGACTTCCATGAGAC
TGGCCGGAACCTATACAGACGACCCACGCGACCACTAAAACTATGCACTAAGGAGCGTTTTAGTCGGTGGCGCACAGCGGATGACTTCGCATTTGACAAA
GGCACTGGTGATGACGTTTTGACCTGGAATGTAACCACGATCTTGTGCTTCTTTGAGACTCCCACCGACTTATCGTTGCTGGCCTTAGCCGAGACAACTA
CCAGGGGCTTGGCACCGCTCTCATCTCCTGTGGTCACAGTCGTTTTAAGACTAGCCAGGAACCCATTCATGTCCAAATCCTTTGTCTTCGCCAGCAGCGG
CTTCGATGCAGTTGAAACCTTCGAAGGGatctcttcctgctgtttcttggccGCTTCAACAACCTCTTTTGCCTTAGCCTTCacctcctccgcctccttA
GCCTTGGGCTGGGGTCGTTCGGACAGAGGTAGCACTCGAGAGTAGAAAAGCATGTAAGCCTTCTGTTGCAACACCGTATCCAGGCTCACCCACCGCACCG
TGTCATCATTCATCTCATACCATTGACCTGAGGAGCCTTTCACAAAGGCATAGTAATGACCGCAGTCCGTGGAAAACCCTGCGTGGACTAACACAGCATG
CAGCTCATATTTCGTACGTCCGCGTCGGCGGTCCTCACAGTTTTTGCTCATACCCGAAGCAATGTCGAGCGAACGAGGGAACT